Incidental Mutation 'R8335:Vsig10'
ID644576
Institutional Source Beutler Lab
Gene Symbol Vsig10
Ensembl Gene ENSMUSG00000066894
Gene NameV-set and immunoglobulin domain containing 10
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_001033311; MGI: 2448533

Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R8335 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location117319083-117355005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117348370 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 448 (L448P)
Ref Sequence ENSEMBL: ENSMUSP00000107598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086464] [ENSMUST00000111967]
Predicted Effect probably damaging
Transcript: ENSMUST00000086464
AA Change: L421P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000083655
Gene: ENSMUSG00000066894
AA Change: L421P

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
IG 23 114 4.03e-8 SMART
IG 132 214 9.49e-5 SMART
Pfam:Ig_2 215 300 2.6e-2 PFAM
Pfam:Ig_3 216 284 3.5e-4 PFAM
IGc2 313 384 1.12e-6 SMART
transmembrane domain 403 425 N/A INTRINSIC
coiled coil region 446 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111967
AA Change: L448P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107598
Gene: ENSMUSG00000066894
AA Change: L448P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 50 141 4.03e-8 SMART
IG 159 241 9.49e-5 SMART
Blast:IG_like 248 327 2e-33 BLAST
IGc2 340 411 1.12e-6 SMART
transmembrane domain 430 452 N/A INTRINSIC
coiled coil region 473 508 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI

All alleles(11) : Gene trapped(11)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc47 C G 11: 106,208,258 E202D possibly damaging Het
Ccdc47 T C 11: 106,208,259 E202G probably damaging Het
Depdc1a C A 3: 159,523,222 P537Q probably damaging Het
Dync2h1 A T 9: 7,084,941 M2816K probably benign Het
Gatb T C 3: 85,574,321 probably null Het
Gm6356 A G 14: 6,971,838 M99T probably benign Het
Ighv1-67 A C 12: 115,604,124 V56G probably damaging Het
Il27ra A T 8: 84,039,501 L218Q probably damaging Het
Madd G A 2: 91,170,239 R494C probably damaging Het
Mfsd8 G A 3: 40,835,193 R140C probably damaging Het
Mink1 C T 11: 70,609,575 R784W probably damaging Het
Mttp C T 3: 138,103,212 D697N possibly damaging Het
Mug2 A T 6: 122,040,584 M427L probably benign Het
Olfr1087 T A 2: 86,690,168 D269V probably benign Het
Olfr1122 A G 2: 87,387,860 I52V probably benign Het
Olfr1200 G T 2: 88,767,773 P181T probably damaging Het
Olfr1402 T C 3: 97,410,708 N158D probably benign Het
Paxip1 T C 5: 27,766,124 H409R unknown Het
Pkp3 T C 7: 141,087,756 I490T probably damaging Het
Plekhg4 G T 8: 105,376,216 V236L probably damaging Het
Pm20d2 T C 4: 33,189,245 S46G probably benign Het
Prss33 A G 17: 23,834,595 probably null Het
Ptpn3 A T 4: 57,235,286 L358I probably damaging Het
Pxdn A G 12: 30,002,097 T758A probably damaging Het
Sall3 G A 18: 80,969,586 R1212C probably benign Het
Sox6 G A 7: 115,701,714 L173F probably damaging Het
Spata20 T C 11: 94,482,543 K501E probably benign Het
Stat2 G A 10: 128,276,583 V31I possibly damaging Het
Synpo2 T A 3: 123,114,534 N378Y probably damaging Het
Tacr2 A T 10: 62,265,167 H352L probably benign Het
Tmem214 A G 5: 30,872,122 K230E possibly damaging Het
Tnfsf8 A G 4: 63,834,115 S238P probably damaging Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Trhde A G 10: 114,486,704 probably null Het
Ttc6 A G 12: 57,660,291 I661M probably benign Het
Vmn1r209 T A 13: 22,805,807 M238L probably damaging Het
Vmn2r29 A G 7: 7,231,446 S814P probably damaging Het
Zfp616 A T 11: 74,083,900 K423* probably null Het
Other mutations in Vsig10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Vsig10 APN 5 117338414 missense probably benign 0.00
IGL00340:Vsig10 APN 5 117351587 missense probably benign 0.03
IGL01082:Vsig10 APN 5 117334905 missense probably benign 0.33
IGL01285:Vsig10 APN 5 117324889 missense probably benign 0.43
IGL01790:Vsig10 APN 5 117338314 missense probably damaging 1.00
IGL03004:Vsig10 APN 5 117325075 missense probably damaging 1.00
D3080:Vsig10 UTSW 5 117343819 missense probably damaging 1.00
R0101:Vsig10 UTSW 5 117335069 critical splice donor site probably null
R0403:Vsig10 UTSW 5 117338461 missense probably benign 0.05
R0674:Vsig10 UTSW 5 117343846 missense probably damaging 1.00
R1437:Vsig10 UTSW 5 117351570 missense probably damaging 0.96
R1689:Vsig10 UTSW 5 117352760 missense probably benign 0.00
R1710:Vsig10 UTSW 5 117351654 missense probably benign
R1765:Vsig10 UTSW 5 117318815 unclassified probably benign
R4422:Vsig10 UTSW 5 117324921 missense probably benign 0.00
R4541:Vsig10 UTSW 5 117352816 utr 3 prime probably benign
R4909:Vsig10 UTSW 5 117338243 missense probably benign 0.31
R4999:Vsig10 UTSW 5 117343975 missense probably damaging 1.00
R5855:Vsig10 UTSW 5 117338270 missense probably damaging 1.00
R5866:Vsig10 UTSW 5 117352749 critical splice acceptor site probably null
R6214:Vsig10 UTSW 5 117343924 missense probably damaging 1.00
R6418:Vsig10 UTSW 5 117348296 missense probably benign 0.03
R6505:Vsig10 UTSW 5 117351759 missense possibly damaging 0.95
R6854:Vsig10 UTSW 5 117338407 missense probably benign 0.36
R7121:Vsig10 UTSW 5 117343902 missense probably damaging 1.00
R7596:Vsig10 UTSW 5 117334783 missense possibly damaging 0.46
R8066:Vsig10 UTSW 5 117351784 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTTGGTCTGACTCTGTAAATTCTATC -3'
(R):5'- GCCCATTACTGCTCGGTCAT -3'

Sequencing Primer
(F):5'- GGGTTCTGTGGACATGAAACC -3'
(R):5'- ACTGCTCGGTCATCTTTCCAG -3'
Posted On2020-09-02