Mutagenetix > Incidental Mutation

Incidental Mutation 'R0039:Gnaz'

64640

Institutional Source

Beutler Lab

Gene Symbol

Gnaz

Ensembl Gene

ENSMUSG00000040009

Gene Name

guanine nucleotide binding protein, alpha z subunit

Synonyms

MMRRC Submission

038333-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0039 (G1)

Quality Score

103

Status

Not validated

Chromosome

Chromosomal Location

74803009-74852739 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74850866 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 297 (Y297C)

Ref Sequence

ENSEMBL: ENSMUSP00000124639 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009214] [ENSMUST00000037813] [ENSMUST00000159991] [ENSMUST00000160072] [ENSMUST00000160450] [ENSMUST00000166088] [ENSMUST00000179546]

AlphaFold

O70443

Predicted Effect

probably benign
Transcript: ENSMUST00000009214

SMART Domains

Protein: ENSMUSP00000009214
Gene: ENSMUSG00000009070

Domain	Start	End	E-Value	Type
Pfam:HEAT_2	28	133	9.9e-8	PFAM
ARM	138	178	3.18e1	SMART
ARM	218	258	1.88e0	SMART
ARM	259	300	3.32e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000037813
AA Change: Y297C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000036087
Gene: ENSMUSG00000040009
AA Change: Y297C

Domain	Start	End	E-Value	Type
G_alpha	13	354	1.05e-210	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000159991
AA Change: Y297C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000124639
Gene: ENSMUSG00000040009
AA Change: Y297C

Domain	Start	End	E-Value	Type
G_alpha	13	354	1.05e-210	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160072

SMART Domains

Protein: ENSMUSP00000123760
Gene: ENSMUSG00000009070

Domain	Start	End	E-Value	Type
Pfam:HEAT_2	28	133	1.6e-8	PFAM
Blast:ARM	138	161	2e-7	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000160450

SMART Domains

Protein: ENSMUSP00000125289
Gene: ENSMUSG00000009070

Domain	Start	End	E-Value	Type
Pfam:HEAT_2	28	133	4.1e-8	PFAM
Blast:ARM	138	178	3e-19	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000166088

SMART Domains

Protein: ENSMUSP00000131632
Gene: ENSMUSG00000009070

Domain	Start	End	E-Value	Type
Blast:ARM	48	88	1e-7	BLAST
Blast:ARM	89	129	3e-16	BLAST
ARM	171	211	3.18e1	SMART
ARM	251	291	1.88e0	SMART
ARM	292	333	3.32e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179546

SMART Domains

Protein: ENSMUSP00000136715
Gene: ENSMUSG00000009070

Domain	Start	End	E-Value	Type
Pfam:HEAT_2	28	133	9.9e-8	PFAM
ARM	138	178	3.18e1	SMART
ARM	218	258	1.88e0	SMART
ARM	259	300	3.32e-1	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a G protein subfamily that mediates signal transduction in pertussis toxin-insensitive systms. This encoded protein may play a role in maintaining the ionic balance of perilymphatic and endolymphatic cochlear fluids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypertolerance to morphine. Mice homozygous for a reporter allele exhibit impaired platelet aggregation, increased resistance to fatal thromboembolism, reduced morphine-elicited antinociception, and altered behavioral responses to addictive substances. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atic	A	T	1: 71,617,009 (GRCm39)	E523V	possibly damaging	Het
Col18a1	T	G	10: 76,913,002 (GRCm39)	K744N	probably damaging	Het
Degs2	A	T	12: 108,656,848 (GRCm39)	Y283N	probably damaging	Het
Eif3m	A	T	2: 104,836,217 (GRCm39)	V209E	probably damaging	Het
Esyt1	A	G	10: 128,356,831 (GRCm39)	V300A	probably damaging	Het
Lmtk2	G	T	5: 144,103,205 (GRCm39)	L321F	probably damaging	Het
Map3k10	A	G	7: 27,357,523 (GRCm39)	S752P	possibly damaging	Het
Mcoln2	C	T	3: 145,889,316 (GRCm39)	T374M	probably damaging	Het
Mroh8	T	C	2: 157,071,849 (GRCm39)	H552R	possibly damaging	Het
Rhbdl2	T	A	4: 123,703,822 (GRCm39)	N32K	probably benign	Het
Rreb1	C	T	13: 38,083,613 (GRCm39)	T92M	probably damaging	Het
Specc1	A	T	11: 61,920,195 (GRCm39)	M32L	probably damaging	Het
Stk31	T	C	6: 49,419,192 (GRCm39)	W700R	probably damaging	Het

Other mutations in Gnaz

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Gnaz	APN	10	74,827,776 (GRCm39)	missense	probably damaging	1.00
IGL01942:Gnaz	APN	10	74,850,706 (GRCm39)	missense	probably damaging	1.00
IGL02695:Gnaz	APN	10	74,827,974 (GRCm39)	critical splice donor site	probably null
R1768:Gnaz	UTSW	10	74,827,702 (GRCm39)	missense	possibly damaging	0.77
R4924:Gnaz	UTSW	10	74,827,545 (GRCm39)	missense	probably benign	0.00
R5209:Gnaz	UTSW	10	74,827,823 (GRCm39)	missense	probably benign	0.00
R5747:Gnaz	UTSW	10	74,827,235 (GRCm39)	intron	probably benign
R5798:Gnaz	UTSW	10	74,850,703 (GRCm39)	missense	probably damaging	1.00
R6976:Gnaz	UTSW	10	74,827,268 (GRCm39)	missense	possibly damaging	0.63
R9278:Gnaz	UTSW	10	74,827,437 (GRCm39)	missense	probably benign	0.00
Z1177:Gnaz	UTSW	10	74,850,792 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- TCATTGCCCAGAGGAAGAGTCCAG -3'
(R):5'- CCTCAGCAAAGGCCGATGTACTTG -3'

Sequencing Primer
(F):5'- tccacccacccacccac -3'
(R):5'- CAAAGGCCGATGTACTTGAGATTG -3'

Posted On

2013-08-06