Incidental Mutation 'R3893:Tmem181a'
ID310058
Institutional Source Beutler Lab
Gene Symbol Tmem181a
Ensembl Gene ENSMUSG00000038141
Gene Nametransmembrane protein 181A
SynonymsTmem181, 5930418K15Rik, Gpr178, C76977
MMRRC Submission 040805-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3893 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location6256860-6308314 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6295786 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 185 (L185H)
Ref Sequence ENSEMBL: ENSMUSP00000086333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088940] [ENSMUST00000232383]
Predicted Effect probably damaging
Transcript: ENSMUST00000088940
AA Change: L185H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000086333
Gene: ENSMUSG00000038141
AA Change: L185H

DomainStartEndE-ValueType
transmembrane domain 17 36 N/A INTRINSIC
Pfam:MIG-14_Wnt-bd 127 422 1e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231593
Predicted Effect probably damaging
Transcript: ENSMUST00000232383
AA Change: L226H

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.2866 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The TMEM181 gene encodes a putative G protein-coupled receptor expressed on the cell surface (Carette et al., 2009 [PubMed 19965467]; Wollscheid et al., 2009 [PubMed 19349973]).[supplied by OMIM, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,631,458 M134L probably benign Het
2610303G11Rik A T 9: 98,186,811 noncoding transcript Het
Adam19 C T 11: 46,128,838 A455V probably damaging Het
Akr1c19 G A 13: 4,238,442 D140N probably damaging Het
Atoh1 A G 6: 64,730,133 T271A probably damaging Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cadps A G 14: 12,488,883 probably benign Het
Cfap69 A T 5: 5,581,245 V61E probably damaging Het
Chd5 A G 4: 152,360,656 R365G probably damaging Het
Dnajc18 A T 18: 35,700,995 probably null Het
Fam49a T C 12: 12,362,525 V232A probably benign Het
Fmnl1 T A 11: 103,196,757 probably benign Het
Gca A G 2: 62,679,220 Y89C probably damaging Het
Gcnt2 A G 13: 40,860,446 Y31C probably benign Het
Gem C T 4: 11,705,889 probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Gprin3 T C 6: 59,354,479 Y281C probably benign Het
H2-M11 A G 17: 36,547,090 T6A probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lrrk1 T C 7: 66,278,520 probably benign Het
Macf1 A G 4: 123,486,406 Y1298H probably damaging Het
Micu3 C T 8: 40,366,224 L315F probably damaging Het
Pkd1 G A 17: 24,572,110 probably null Het
Pkhd1 A T 1: 20,312,138 Y2596* probably null Het
Pnliprp2 A G 19: 58,766,273 S250G probably benign Het
Prkcq A C 2: 11,226,971 E35A probably damaging Het
Prpf8 C A 11: 75,500,257 S1377R possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rsbn1l C T 5: 20,905,840 R500H probably damaging Het
Sart3 C T 5: 113,746,636 E636K probably benign Het
Skint3 A G 4: 112,253,918 K80R probably damaging Het
Slc11a1 G A 1: 74,384,706 A398T probably damaging Het
Sspo G T 6: 48,476,571 E2887* probably null Het
Tmc5 A C 7: 118,645,369 Y490S probably damaging Het
Tnfsf8 G T 4: 63,860,959 T34K possibly damaging Het
Trim5 T A 7: 104,276,835 N173I probably damaging Het
Vkorc1l1 A T 5: 129,982,271 I109L probably benign Het
Vmn1r214 A G 13: 23,034,641 T102A probably benign Het
Wdr19 A G 5: 65,228,292 D579G possibly damaging Het
Zc3h6 A G 2: 129,016,140 Y697C probably damaging Het
Zfp955b T C 17: 33,302,994 I479T probably benign Het
Other mutations in Tmem181a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02071:Tmem181a APN 17 6297256 missense probably damaging 1.00
IGL03027:Tmem181a APN 17 6298219 missense probably damaging 1.00
a_team UTSW 17 6295786 missense probably damaging 0.99
abraham UTSW 17 6290599 missense probably benign 0.03
PIT4651001:Tmem181a UTSW 17 6300895 missense probably benign
R1966:Tmem181a UTSW 17 6303226 missense probably benign
R2139:Tmem181a UTSW 17 6298206 missense probably damaging 1.00
R2323:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R2324:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3001:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3002:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3003:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3034:Tmem181a UTSW 17 6280626 missense possibly damaging 0.50
R3425:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3426:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3427:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3428:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3499:Tmem181a UTSW 17 6280619 nonsense probably null
R3683:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4226:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4227:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4428:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4429:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4430:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4465:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4466:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4467:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4496:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4728:Tmem181a UTSW 17 6290599 missense probably benign 0.03
R4822:Tmem181a UTSW 17 6280665 missense probably benign 0.00
R5301:Tmem181a UTSW 17 6295795 missense possibly damaging 0.52
R5991:Tmem181a UTSW 17 6289037 missense probably damaging 1.00
R6052:Tmem181a UTSW 17 6280615 missense probably damaging 1.00
R6222:Tmem181a UTSW 17 6300917 missense probably benign 0.29
R7131:Tmem181a UTSW 17 6297972 missense probably damaging 0.98
R7231:Tmem181a UTSW 17 6297920 missense possibly damaging 0.81
R7374:Tmem181a UTSW 17 6304258 missense possibly damaging 0.85
R7437:Tmem181a UTSW 17 6303265 missense possibly damaging 0.70
R7592:Tmem181a UTSW 17 6289020 missense probably benign 0.00
R8175:Tmem181a UTSW 17 6295800 missense probably benign 0.00
R8327:Tmem181a UTSW 17 6301405 missense probably damaging 1.00
R8385:Tmem181a UTSW 17 6288999 missense probably benign 0.10
RF010:Tmem181a UTSW 17 6280703 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCATGGGAGAACTGTTTCTGG -3'
(R):5'- GTGGTCAGCAATGACTCTCAC -3'

Sequencing Primer
(F):5'- CCATGGGAGAACTGTTTCTGGTAGTC -3'
(R):5'- TGGTCAGCAATGACTCTCACACTAC -3'
Posted On2015-04-17