Incidental Mutation 'R8120:Tub'
ID647932
Institutional Source Beutler Lab
Gene Symbol Tub
Ensembl Gene ENSMUSG00000031028
Gene Nametubby bipartite transcription factor
Synonymsrd5, tub
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8120 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location108950338-109034460 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 109025596 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033341] [ENSMUST00000119474] [ENSMUST00000207583]
Predicted Effect probably null
Transcript: ENSMUST00000033341
SMART Domains Protein: ENSMUSP00000033341
Gene: ENSMUSG00000031028

DomainStartEndE-ValueType
Pfam:Tub_N 29 237 2.5e-58 PFAM
Pfam:Tub 257 499 2.4e-88 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119474
SMART Domains Protein: ENSMUSP00000113580
Gene: ENSMUSG00000031028

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 55 77 N/A INTRINSIC
low complexity region 145 174 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
Pfam:Tub 211 453 2.4e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207583
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 95.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Tubby family of bipartite transcription factors. The encoded protein may play a role in obesity and sensorineural degradation. The crystal structure has been determined for a similar protein in mouse, and it functions as a membrane-bound transcription regulator that translocates to the nucleus in response to phosphoinositide hydrolysis. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit a late-developing obesity with hyperinsulinemia, retinal degeneration, and hearing loss associated with death of both outer and inner hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,622,890 Q239L probably benign Het
Abca12 T C 1: 71,259,381 I2361V possibly damaging Het
Abcc8 T C 7: 46,136,684 E655G probably benign Het
Ablim1 C T 19: 57,046,928 V662I probably benign Het
Als2cl A C 9: 110,885,392 I103L possibly damaging Het
Arhgef26 A T 3: 62,341,375 D370V probably damaging Het
BC003331 T C 1: 150,384,426 probably null Het
Brwd1 A C 16: 96,019,449 D1292E probably benign Het
Cdc5l T C 17: 45,407,870 T607A probably benign Het
Cfhr1 T C 1: 139,547,845 Y296C unknown Het
Cubn A T 2: 13,331,660 C2452S probably damaging Het
D3Ertd254e A T 3: 36,164,491 N221I possibly damaging Het
Dgcr2 A T 16: 17,857,319 Y187* probably null Het
Dhodh G A 8: 109,601,425 T172I probably benign Het
Dnah6 G A 6: 73,025,786 R3876C probably damaging Het
Fam71a T G 1: 191,162,825 Q540H probably damaging Het
Farsb A T 1: 78,462,838 N389K probably benign Het
Fryl T C 5: 73,071,184 T1735A probably benign Het
Gm498 A G 7: 143,871,787 T58A probably benign Het
Gpcpd1 C T 2: 132,554,023 R136H probably damaging Het
Gpr171 T A 3: 59,097,985 Y123F probably damaging Het
Hcar1 C A 5: 123,879,005 V208F probably damaging Het
Hgf T A 5: 16,613,781 L524M probably damaging Het
Itga2b A T 11: 102,469,542 H57Q probably damaging Het
Itpripl2 G T 7: 118,490,285 N350K probably damaging Het
Limk2 C T 11: 3,348,589 probably null Het
Nae1 A T 8: 104,519,635 V315E probably damaging Het
Nars T C 18: 64,504,351 Y386C probably benign Het
Olfr1346 A T 7: 6,474,120 R3S probably benign Het
Olfr218 C T 1: 173,203,935 T193I probably benign Het
Pcnx3 C T 19: 5,667,546 A1512T probably benign Het
Pde1b A G 15: 103,522,097 D176G possibly damaging Het
Pde4dip T A 3: 97,706,938 T1855S probably null Het
Prr12 A G 7: 45,034,742 Y1625H probably damaging Het
Psmc2 T C 5: 21,800,568 Y216H probably damaging Het
Ptchd3 A T 11: 121,842,208 E641D probably benign Het
Rtf1 A G 2: 119,701,121 T110A probably damaging Het
Rusc1 C A 3: 89,089,206 W690L probably damaging Het
Sardh A G 2: 27,218,851 V624A possibly damaging Het
Slc17a9 G A 2: 180,732,515 G125S probably benign Het
Smpdl3a A T 10: 57,807,451 N219I probably damaging Het
Spo11 G T 2: 172,985,458 D155Y probably damaging Het
Stk38l A G 6: 146,758,601 T44A probably benign Het
Tceanc2 A T 4: 107,177,632 I11N probably benign Het
Tead2 A T 7: 45,216,328 probably benign Het
Tpk1 A G 6: 43,468,996 probably null Het
Ttn T C 2: 76,763,491 N20602D probably damaging Het
Uba2 A T 7: 34,168,387 S42T probably benign Het
Vangl1 T A 3: 102,163,442 R393* probably null Het
Washc3 G A 10: 88,201,297 probably null Het
Wdr78 G A 4: 103,066,334 R433W probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp386 C T 12: 116,054,953 P81S unknown Het
Zw10 A T 9: 49,074,113 E616D probably benign Het
Other mutations in Tub
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01694:Tub APN 7 109021036 splice site probably benign
IGL02715:Tub APN 7 109029310 missense probably benign
grasso UTSW 7 109029650 missense probably damaging 1.00
troy UTSW 7 109020954 nonsense probably null
R0152:Tub UTSW 7 109020927 missense probably damaging 1.00
R0233:Tub UTSW 7 109029341 missense possibly damaging 0.63
R0233:Tub UTSW 7 109029341 missense possibly damaging 0.63
R0317:Tub UTSW 7 109020927 missense probably damaging 1.00
R1382:Tub UTSW 7 109030153 missense probably damaging 1.00
R1395:Tub UTSW 7 109020954 nonsense probably null
R1588:Tub UTSW 7 109029681 missense probably damaging 1.00
R1975:Tub UTSW 7 109027835 missense possibly damaging 0.74
R2047:Tub UTSW 7 109026732 missense probably benign 0.30
R2121:Tub UTSW 7 109026737 missense probably damaging 1.00
R2414:Tub UTSW 7 109027033 missense probably damaging 1.00
R3694:Tub UTSW 7 109027832 missense probably benign
R3695:Tub UTSW 7 109027832 missense probably benign
R4914:Tub UTSW 7 109020954 nonsense probably null
R5139:Tub UTSW 7 109011102 start codon destroyed probably null 0.53
R5347:Tub UTSW 7 109026771 missense possibly damaging 0.67
R5557:Tub UTSW 7 109025718 missense probably damaging 0.99
R6000:Tub UTSW 7 109029650 missense probably damaging 1.00
R6245:Tub UTSW 7 109027058 missense probably damaging 1.00
R6888:Tub UTSW 7 109029298 missense probably null 1.00
R7316:Tub UTSW 7 109030171 missense possibly damaging 0.69
R8223:Tub UTSW 7 109029326 missense probably benign 0.33
RF005:Tub UTSW 7 109022639 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGTTCATGTGTGCACCAG -3'
(R):5'- CTACTGGCAGAGCTAACTACTG -3'

Sequencing Primer
(F):5'- CAGAGAGAACCCGTGTCCTTGTATG -3'
(R):5'- GCAGAGCTAACTACTGACGGC -3'
Posted On2020-09-11