Incidental Mutation 'R7983:Cyp2a5'
ID651317
Institutional Source Beutler Lab
Gene Symbol Cyp2a5
Ensembl Gene ENSMUSG00000005547
Gene Namecytochrome P450, family 2, subfamily a, polypeptide 5
SynonymsCoh
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7983 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location26835305-26843548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26840441 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 305 (T305S)
Ref Sequence ENSEMBL: ENSMUSP00000005685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005685] [ENSMUST00000168869] [ENSMUST00000169007]
Predicted Effect probably benign
Transcript: ENSMUST00000005685
AA Change: T305S

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000005685
Gene: ENSMUSG00000005547
AA Change: T305S

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 34 491 4e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168869
SMART Domains Protein: ENSMUSP00000130640
Gene: ENSMUSG00000005547

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
PDB:2PG7|D 25 60 9e-14 PDB
SCOP:d1jpza_ 30 60 6e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169007
SMART Domains Protein: ENSMUSP00000128865
Gene: ENSMUSG00000005547

DomainStartEndE-ValueType
Pfam:p450 1 116 1.1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170631
SMART Domains Protein: ENSMUSP00000127829
Gene: ENSMUSG00000005547

DomainStartEndE-ValueType
Pfam:p450 1 59 2.9e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (39/41)
MGI Phenotype PHENOTYPE: Mice exhibit strain-specific cytochrome activity levels. Mice homozygous for a knock-out allele exhibit slower clearance of nicotine and cotinine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik C A 6: 96,165,907 G52V probably damaging Het
2410089E03Rik T A 15: 8,221,815 V1857E probably benign Het
Casd1 G T 6: 4,624,472 E422* probably null Het
Ccdc7a T C 8: 128,881,078 T1007A possibly damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cds2 T G 2: 132,263,510 probably null Het
Cfap100 G A 6: 90,415,705 T141I Het
Chd7 T A 4: 8,752,628 M375K unknown Het
Chd7 T A 4: 8,844,609 S1573T possibly damaging Het
Crybb2 T C 5: 113,062,080 E139G probably benign Het
Csn2 T C 5: 87,694,497 T224A probably benign Het
Csnk2b T C 17: 35,116,328 H231R possibly damaging Het
Cthrc1 A G 15: 39,077,155 D51G probably benign Het
Cyp4a29 A T 4: 115,250,902 D307V probably damaging Het
Dhrs7b T C 11: 60,852,461 V188A possibly damaging Het
Dna2 A G 10: 62,955,394 D224G probably benign Het
Dnah7b T A 1: 46,243,424 L2906M probably damaging Het
Eif4g3 A T 4: 138,151,593 E545D probably benign Het
Foxq1 T C 13: 31,559,989 F358S possibly damaging Het
Galnt16 C T 12: 80,601,824 H557Y probably benign Het
Kcnb2 T C 1: 15,312,780 M110T probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Nalcn T C 14: 123,592,997 I144V probably benign Het
Napsa T A 7: 44,585,327 N295K possibly damaging Het
Olfr172 G A 16: 58,761,014 S54F probably benign Het
Olfr704 T C 7: 106,865,751 V257A probably benign Het
Plch1 T C 3: 63,707,743 D778G probably damaging Het
Pnlip G A 19: 58,680,059 V361I probably benign Het
Pou4f2 G T 8: 78,434,939 A345E probably benign Het
Prr11 C T 11: 87,091,811 D365N possibly damaging Het
Ptprq G T 10: 107,608,411 S1444* probably null Het
R3hdm4 A T 10: 79,912,723 V129E probably damaging Het
Retnlg T C 16: 48,872,898 S13P probably damaging Het
Rgmb T C 17: 15,820,927 T133A possibly damaging Het
Rin3 A C 12: 102,369,159 H443P probably benign Het
Rnf152 T C 1: 105,284,364 D156G probably benign Het
Sfmbt1 A G 14: 30,797,716 probably null Het
Slc25a46 G A 18: 31,583,430 R340C probably damaging Het
Sp4 A T 12: 118,301,232 M1K probably null Het
Ss18l2 T C 9: 121,712,609 I64T probably damaging Het
Sult2a4 G A 7: 13,915,227 S219F probably damaging Het
Tnip3 A C 6: 65,538,646 D25A probably damaging Het
Trac A G 14: 54,220,757 T79A Het
Vmn2r36 A G 7: 7,902,416 L16P probably damaging Het
Zswim2 A G 2: 83,923,567 probably null Het
Other mutations in Cyp2a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01354:Cyp2a5 APN 7 26837103 missense possibly damaging 0.82
IGL01744:Cyp2a5 APN 7 26841009 missense probably damaging 1.00
IGL02155:Cyp2a5 APN 7 26843046 missense probably benign 0.06
IGL03076:Cyp2a5 APN 7 26835874 missense probably damaging 0.99
PIT4696001:Cyp2a5 UTSW 7 26840979 missense probably benign 0.18
R0762:Cyp2a5 UTSW 7 26838873 nonsense probably null
R0980:Cyp2a5 UTSW 7 26839006 splice site probably null
R1078:Cyp2a5 UTSW 7 26835541 missense probably benign 0.33
R1511:Cyp2a5 UTSW 7 26835936 missense probably damaging 1.00
R1780:Cyp2a5 UTSW 7 26841876 intron probably benign
R1803:Cyp2a5 UTSW 7 26835546 splice site probably null
R1899:Cyp2a5 UTSW 7 26839033 nonsense probably null
R1977:Cyp2a5 UTSW 7 26835922 missense probably benign 0.15
R2215:Cyp2a5 UTSW 7 26840475 missense probably damaging 1.00
R2258:Cyp2a5 UTSW 7 26837103 missense possibly damaging 0.82
R3051:Cyp2a5 UTSW 7 26842985 missense possibly damaging 0.77
R3052:Cyp2a5 UTSW 7 26842985 missense possibly damaging 0.77
R3053:Cyp2a5 UTSW 7 26842985 missense possibly damaging 0.77
R4387:Cyp2a5 UTSW 7 26841054 missense probably damaging 0.97
R4832:Cyp2a5 UTSW 7 26835545 critical splice donor site probably null
R5054:Cyp2a5 UTSW 7 26841104 missense probably damaging 1.00
R5622:Cyp2a5 UTSW 7 26835874 missense probably damaging 1.00
R5867:Cyp2a5 UTSW 7 26842958 missense probably benign 0.09
R5998:Cyp2a5 UTSW 7 26837153 missense probably benign 0.00
R6186:Cyp2a5 UTSW 7 26843388 unclassified probably benign
R7338:Cyp2a5 UTSW 7 26842947 missense probably damaging 1.00
R7350:Cyp2a5 UTSW 7 26836783 missense probably benign 0.37
R7536:Cyp2a5 UTSW 7 26840478 missense probably damaging 1.00
R7722:Cyp2a5 UTSW 7 26837118 missense probably benign 0.31
R7831:Cyp2a5 UTSW 7 26835515 missense possibly damaging 0.71
R8805:Cyp2a5 UTSW 7 26841105 missense probably damaging 0.99
Z1088:Cyp2a5 UTSW 7 26841107 missense probably damaging 1.00
Z1176:Cyp2a5 UTSW 7 26835497 missense probably damaging 1.00
Z1176:Cyp2a5 UTSW 7 26836774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACCTTAGGTCTAAGCCAAAG -3'
(R):5'- GTGGCTCTGTCTAGGTAAAGC -3'

Sequencing Primer
(F):5'- CCTTAGGTCTAAGCCAAAGAGAAGTG -3'
(R):5'- GGGAGTAACTAGTTATCTGAGAATCC -3'
Posted On2020-09-15