Incidental Mutation 'R8499:Btbd7'
ID 658431
Institutional Source Beutler Lab
Gene Symbol Btbd7
Ensembl Gene ENSMUSG00000041702
Gene Name BTB (POZ) domain containing 7
Synonyms FUP1, E130118E17Rik, 5730507E09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock # R8499 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 102780797-102878471 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102788372 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 712 (F712I)
Ref Sequence ENSEMBL: ENSMUSP00000152426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045652] [ENSMUST00000223554]
AlphaFold Q8CFE5
Predicted Effect probably damaging
Transcript: ENSMUST00000045652
AA Change: F712I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046951
Gene: ENSMUSG00000041702
AA Change: F712I

DomainStartEndE-ValueType
BTB 142 244 1.57e-13 SMART
BTB 247 397 2.23e-4 SMART
BACK 402 538 1.49e-4 SMART
low complexity region 626 640 N/A INTRINSIC
low complexity region 756 771 N/A INTRINSIC
low complexity region 783 792 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 839 850 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223554
AA Change: F712I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.0746 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 40,755,152 D485G probably damaging Het
Ap4b1 G A 3: 103,820,702 R344Q probably damaging Het
Apol7c G T 15: 77,526,080 P222Q possibly damaging Het
Atf6b T C 17: 34,650,822 L272P probably damaging Het
Atp11b G T 3: 35,810,705 R559I probably benign Het
Bhmt T A 13: 93,620,092 I343F probably benign Het
Card14 T C 11: 119,331,244 L455P probably benign Het
Cast A T 13: 74,798,716 H26Q probably benign Het
Clcn1 A G 6: 42,307,199 N567S probably damaging Het
Cnot6l A T 5: 96,077,317 W506R probably damaging Het
Dynap T A 18: 70,240,973 I161L unknown Het
Eif4g3 A C 4: 138,165,928 T996P probably damaging Het
Exoc8 A G 8: 124,897,110 Y173H probably benign Het
Fbll1 C T 11: 35,798,080 V119M probably damaging Het
Fbxw22 A T 9: 109,385,000 F249L probably benign Het
Fxyd1 C A 7: 31,053,104 probably benign Het
Gm10130 T C 2: 150,362,987 S74P probably benign Het
Grhl3 C A 4: 135,549,238 probably null Het
Grk4 A G 5: 34,745,346 E414G possibly damaging Het
H2-Q5 A G 17: 35,394,844 D123G Het
H2-Q5 C T 17: 35,394,969 R165* probably null Het
Hgf A T 5: 16,566,856 E160D probably damaging Het
Hist1h2bg T A 13: 23,571,706 S92T probably benign Het
Ifi211 T C 1: 173,905,520 I192V probably benign Het
Klk1b22 T C 7: 44,112,720 F7L probably benign Het
Lcmt1 C A 7: 123,430,148 T331N probably benign Het
Lrrc36 A T 8: 105,449,536 T181S possibly damaging Het
Ltbp3 T A 19: 5,748,684 S520T probably benign Het
Nacc1 A T 8: 84,676,716 C177S probably damaging Het
Nedd4l T A 18: 65,209,657 V888E probably damaging Het
Oc90 C T 15: 65,881,556 G305S probably damaging Het
Olfr556 T A 7: 102,670,805 I295N probably damaging Het
Olfr559 A G 7: 102,723,725 V255A probably damaging Het
Pappa2 T A 1: 158,936,522 D473V probably damaging Het
Pou2f2 C A 7: 25,100,198 G117C probably damaging Het
Prkci A G 3: 31,025,217 H68R probably damaging Het
Pygm A G 19: 6,390,362 K479E probably damaging Het
Qpct A G 17: 79,077,567 D212G probably damaging Het
Sh3glb2 A T 2: 30,359,204 M1K probably null Het
Slc22a5 A G 11: 53,867,643 S444P probably damaging Het
Snai3 G A 8: 122,456,405 H134Y probably benign Het
Synpo T C 18: 60,602,972 D395G probably damaging Het
Tmem63c C T 12: 87,072,964 T344I probably damaging Het
Tnfsf14 A G 17: 57,190,534 Y233H Het
Ttn A G 2: 76,918,991 F3905L probably benign Het
Tubgcp5 T A 7: 55,804,615 H219Q possibly damaging Het
Usp16 C T 16: 87,474,648 T364M possibly damaging Het
Vmn1r59 C T 7: 5,454,751 M3I probably benign Het
Vmn2r61 T A 7: 42,300,276 C707S probably damaging Het
Vps13b T C 15: 35,841,320 S2499P probably damaging Het
Ythdf3 A G 3: 16,205,015 E442G possibly damaging Het
Other mutations in Btbd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02047:Btbd7 APN 12 102793779 missense probably benign 0.10
IGL02899:Btbd7 APN 12 102837662 missense probably damaging 1.00
IGL03204:Btbd7 APN 12 102807980 nonsense probably null
H8562:Btbd7 UTSW 12 102788302 missense probably benign 0.26
IGL03050:Btbd7 UTSW 12 102812806 missense probably benign 0.03
R1262:Btbd7 UTSW 12 102787951 missense probably benign
R1423:Btbd7 UTSW 12 102785475 missense possibly damaging 0.49
R1437:Btbd7 UTSW 12 102788090 missense possibly damaging 0.59
R1636:Btbd7 UTSW 12 102793851 missense probably damaging 1.00
R1641:Btbd7 UTSW 12 102790775 missense probably damaging 1.00
R1722:Btbd7 UTSW 12 102812654 missense possibly damaging 0.96
R1921:Btbd7 UTSW 12 102793796 missense probably benign 0.01
R2021:Btbd7 UTSW 12 102790709 missense probably damaging 1.00
R2180:Btbd7 UTSW 12 102785897 missense probably damaging 1.00
R3768:Btbd7 UTSW 12 102795192 missense probably damaging 1.00
R3770:Btbd7 UTSW 12 102795192 missense probably damaging 1.00
R3786:Btbd7 UTSW 12 102838152 missense probably benign 0.22
R4396:Btbd7 UTSW 12 102785293 missense probably benign 0.00
R4809:Btbd7 UTSW 12 102793744 critical splice donor site probably null
R4910:Btbd7 UTSW 12 102808048 missense probably damaging 0.98
R4915:Btbd7 UTSW 12 102837787 nonsense probably null
R5054:Btbd7 UTSW 12 102838212 missense probably benign 0.02
R5276:Btbd7 UTSW 12 102838392 missense probably benign 0.00
R5387:Btbd7 UTSW 12 102837785 missense probably damaging 0.99
R5665:Btbd7 UTSW 12 102785197 missense probably benign
R7083:Btbd7 UTSW 12 102788335 missense probably damaging 0.99
R7354:Btbd7 UTSW 12 102838205 missense probably benign 0.05
R7429:Btbd7 UTSW 12 102837780 missense probably damaging 1.00
R7462:Btbd7 UTSW 12 102837722 missense possibly damaging 0.88
R7469:Btbd7 UTSW 12 102812768 missense probably damaging 0.99
R7998:Btbd7 UTSW 12 102795240 missense probably damaging 1.00
R8773:Btbd7 UTSW 12 102837982 missense probably benign 0.02
R8783:Btbd7 UTSW 12 102788242 missense probably benign 0.45
R8968:Btbd7 UTSW 12 102812766 missense probably damaging 1.00
R9016:Btbd7 UTSW 12 102785158 missense probably damaging 1.00
R9027:Btbd7 UTSW 12 102838579 missense probably damaging 1.00
R9216:Btbd7 UTSW 12 102795304 missense probably damaging 1.00
R9221:Btbd7 UTSW 12 102811171 missense probably damaging 1.00
X0024:Btbd7 UTSW 12 102812686 nonsense probably null
X0025:Btbd7 UTSW 12 102811164 missense probably benign 0.06
Z1177:Btbd7 UTSW 12 102811120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGCTGTTCTGCAGTGAAAC -3'
(R):5'- AATTAGAGACCAGCCTGTGC -3'

Sequencing Primer
(F):5'- CTGTTCTGCAGTGAAACAGTGAATG -3'
(R):5'- CTGTGCTATCAGGGGAAAAAGAAAAG -3'
Posted On 2021-01-18