Incidental Mutation 'R8681:Vmn1r67'
ID661741
Institutional Source Beutler Lab
Gene Symbol Vmn1r67
Ensembl Gene ENSMUSG00000046716
Gene Namevomeronasal 1 receptor 67
SynonymsV1re10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8681 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location10443331-10449202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10447201 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 131 (I131V)
Ref Sequence ENSEMBL: ENSMUSP00000060746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055964] [ENSMUST00000226237]
Predicted Effect probably benign
Transcript: ENSMUST00000055964
AA Change: I131V

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000060746
Gene: ENSMUSG00000046716
AA Change: I131V

DomainStartEndE-ValueType
Pfam:V1R 34 292 4.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226237
AA Change: I70V

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,190,559 F583S probably damaging Het
A430078G23Rik A G 8: 3,389,074 Y477C unknown Het
Abcc12 A G 8: 86,505,279 V1347A possibly damaging Het
Adam32 G A 8: 24,837,795 T750I unknown Het
Adcy1 T C 11: 7,161,328 I873T probably damaging Het
Aebp1 A G 11: 5,867,899 D438G probably null Het
Anks1b T A 10: 90,050,006 M188K probably damaging Het
Ccdc114 A G 7: 45,941,839 E246G probably damaging Het
Cep112 T C 11: 108,425,652 probably null Het
Clu T C 14: 65,980,957 V422A probably damaging Het
Cntrl T C 2: 35,148,588 L1050P probably damaging Het
Col23a1 A T 11: 51,567,929 T298S possibly damaging Het
Cyp26c1 A T 19: 37,686,617 T129S probably damaging Het
Cyp2c38 A C 19: 39,401,691 V355G possibly damaging Het
Cyp4a30b G A 4: 115,457,745 V175M possibly damaging Het
Cyp7a1 A T 4: 6,271,207 N316K probably benign Het
Dcaf17 T A 2: 71,056,569 Y67* probably null Het
Dll3 T C 7: 28,294,845 D389G probably damaging Het
Fbxo33 A G 12: 59,219,044 F146L probably benign Het
Gm10118 C T 10: 63,926,977 V61M unknown Het
Gm9611 T C 14: 42,296,069 D102G Het
Grik5 G A 7: 25,010,472 A946V probably benign Het
Il17c A G 8: 122,423,468 D150G possibly damaging Het
Ino80e A G 7: 126,861,721 L22P probably damaging Het
Kcnh2 G T 5: 24,331,983 T201K probably benign Het
Klrb1 A C 6: 128,710,049 N173K possibly damaging Het
Kmt2d T A 15: 98,846,067 Q3737H unknown Het
Lemd3 T C 10: 120,931,823 D682G possibly damaging Het
Lilra5 T C 7: 4,238,217 V51A probably benign Het
Lrrc25 G A 8: 70,617,664 V32I possibly damaging Het
Mdh1b T A 1: 63,715,201 M403L probably benign Het
Mms19 G A 19: 41,949,476 L765F probably damaging Het
Msx3 T A 7: 140,048,987 T5S probably benign Het
Myh13 A C 11: 67,352,134 I958L possibly damaging Het
Myo18b T A 5: 112,873,563 probably null Het
Myo9a G A 9: 59,868,111 V1002I probably benign Het
Neb T C 2: 52,237,036 K379R probably damaging Het
Nsmce2 A G 15: 59,601,359 S216G probably benign Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr746 A T 14: 50,653,344 M36L probably benign Het
Pkp2 A T 16: 16,230,681 M317L probably benign Het
Pogz T A 3: 94,860,923 H137Q probably damaging Het
Prrx2 G T 2: 30,845,507 D25Y unknown Het
Ptprf T C 4: 118,231,647 D653G probably benign Het
Rps6kl1 T A 12: 85,147,855 E94V probably damaging Het
Slc44a1 A T 4: 53,481,510 D27V probably damaging Het
Slc44a4 A G 17: 34,928,277 I549V possibly damaging Het
Slc8a3 T C 12: 81,315,140 T302A probably benign Het
Spic T A 10: 88,675,985 K136N possibly damaging Het
Stk36 T C 1: 74,622,233 L473P probably damaging Het
Syce1 G A 7: 140,782,074 T32I possibly damaging Het
Tars2 G A 3: 95,750,887 Q209* probably null Het
Tmem9b A G 7: 109,745,320 V100A probably benign Het
Vmn2r26 C T 6: 124,024,918 T54I probably benign Het
Zfp142 T C 1: 74,571,588 E1016G probably damaging Het
Zfp773 T C 7: 7,136,483 T56A possibly damaging Het
Other mutations in Vmn1r67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01690:Vmn1r67 APN 7 10446840 missense possibly damaging 0.96
IGL02812:Vmn1r67 APN 7 10447018 missense probably benign 0.01
IGL03121:Vmn1r67 APN 7 10447467 missense probably benign 0.00
IGL03208:Vmn1r67 APN 7 10447098 missense possibly damaging 0.94
PIT4142001:Vmn1r67 UTSW 7 10446950 missense probably benign 0.13
R0048:Vmn1r67 UTSW 7 10446866 missense probably damaging 1.00
R0549:Vmn1r67 UTSW 7 10447714 missense probably damaging 1.00
R1595:Vmn1r67 UTSW 7 10447670 missense probably benign 0.18
R1608:Vmn1r67 UTSW 7 10446980 missense possibly damaging 0.82
R2284:Vmn1r67 UTSW 7 10447673 missense probably damaging 0.97
R3614:Vmn1r67 UTSW 7 10447429 missense probably damaging 0.98
R4399:Vmn1r67 UTSW 7 10447549 missense possibly damaging 0.89
R4542:Vmn1r67 UTSW 7 10447430 missense probably damaging 0.99
R5216:Vmn1r67 UTSW 7 10447163 missense probably benign 0.00
R5655:Vmn1r67 UTSW 7 10447388 missense probably benign 0.43
R5837:Vmn1r67 UTSW 7 10447022 missense probably benign 0.26
R6526:Vmn1r67 UTSW 7 10447671 missense probably benign 0.05
R6735:Vmn1r67 UTSW 7 10447211 missense probably damaging 1.00
R6846:Vmn1r67 UTSW 7 10446913 missense probably benign 0.04
R7086:Vmn1r67 UTSW 7 10447117 missense possibly damaging 0.93
R7227:Vmn1r67 UTSW 7 10447548 nonsense probably null
R7594:Vmn1r67 UTSW 7 10447415 missense possibly damaging 0.95
R7608:Vmn1r67 UTSW 7 10447363 missense possibly damaging 0.89
R7797:Vmn1r67 UTSW 7 10446976 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GAATGCCTCACACATTGGC -3'
(R):5'- AGACACTGGACCAGGCAATG -3'

Sequencing Primer
(F):5'- CACACATTGGCAGCTTTTGAG -3'
(R):5'- AAGAAGATTTCAGGGCACACTAC -3'
Posted On2021-03-08