Incidental Mutation 'R8822:Ticam1'
ID673149
Institutional Source Beutler Lab
Gene Symbol Ticam1
Ensembl Gene ENSMUSG00000047123
Gene Nametoll-like receptor adaptor molecule 1
SynonymsTICAM-1, Trif
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8822 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location56269319-56276786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56271444 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 217 (L217P)
Ref Sequence ENSEMBL: ENSMUSP00000055104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058136]
Predicted Effect probably damaging
Transcript: ENSMUST00000058136
AA Change: L217P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055104
Gene: ENSMUSG00000047123
AA Change: L217P

DomainStartEndE-ValueType
PDB:4BSX|D 5 153 3e-52 PDB
low complexity region 345 384 N/A INTRINSIC
SCOP:d1fyva_ 386 491 8e-3 SMART
PDB:2M1X|A 391 547 1e-74 PDB
Pfam:RHIM 610 698 4.7e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein containing a Toll/interleukin-1 receptor (TIR) homology domain, which is an intracellular signaling domain that mediates protein-protein interactions between the Toll-like receptors (TLRs) and signal-transduction components. This protein is involved in native immunity against invading pathogens. It specifically interacts with toll-like receptor 3, but not with other TLRs, and this association mediates dsRNA induction of interferon-beta through activation of nuclear factor kappa-B, during an antiviral immune response. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice are viable but exhibit abnormalities of the innate immune system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,171,778 I13T probably damaging Het
5430419D17Rik A T 7: 131,241,977 probably null Het
Adrb1 T C 19: 56,723,417 V349A probably damaging Het
Atp2a2 A G 5: 122,491,709 V99A possibly damaging Het
Bank1 T A 3: 136,103,879 D418V possibly damaging Het
Cacna1d A G 14: 30,178,735 V331A probably benign Het
Cd28 A T 1: 60,769,661 N178I possibly damaging Het
Ceacam12 T C 7: 18,069,453 probably benign Het
Cfap54 G A 10: 93,039,141 A494V probably benign Het
Chpt1 A G 10: 88,488,406 V180A probably damaging Het
Cyp4a31 G A 4: 115,565,028 E70K probably benign Het
Fam151a A T 4: 106,745,645 M254L probably benign Het
Fyco1 A T 9: 123,819,119 I1250N probably damaging Het
Gm13128 A G 4: 144,330,522 K92E probably benign Het
Gm6685 T G 11: 28,339,768 Q16P probably benign Het
Gpr26 A G 7: 131,967,268 Y114C probably damaging Het
Helb A T 10: 120,105,484 V433D probably benign Het
Hps3 A G 3: 20,003,227 W930R probably benign Het
Igdcc4 C T 9: 65,124,016 T412I possibly damaging Het
Klhl35 T C 7: 99,472,848 V485A probably benign Het
Lman1l A G 9: 57,607,188 V493A probably benign Het
Lmo7 A G 14: 101,884,174 D225G probably damaging Het
Myo15 C T 11: 60,476,914 R167C probably damaging Het
Obp2a A T 2: 25,700,176 D29V probably damaging Het
Olfr535 A G 7: 140,493,013 Y125C possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Olfr74 A G 2: 87,974,441 S75P possibly damaging Het
Olfr958 C A 9: 39,550,516 M118I probably benign Het
Olfr967 A G 9: 39,750,404 Y6C probably benign Het
Pde6b A G 5: 108,403,462 E204G probably benign Het
Pkd1 T C 17: 24,565,641 V387A probably benign Het
Pkd1l1 A T 11: 8,856,312 I2054K Het
Pkp1 T A 1: 135,879,923 M536L probably benign Het
Platr25 T C 13: 62,700,844 E68G probably benign Het
Plxna4 T C 6: 32,150,496 D1892G possibly damaging Het
Prr12 A G 7: 45,050,339 L76P unknown Het
Ptprz1 T A 6: 23,002,589 N1559K probably damaging Het
Rbl2 A T 8: 91,106,718 N750I possibly damaging Het
Rhpn2 A T 7: 35,390,803 M617L probably benign Het
Rprd2 A G 3: 95,784,301 S221P probably damaging Het
S100a4 T C 3: 90,605,051 S14P probably benign Het
Samd11 A T 4: 156,252,307 L25Q probably damaging Het
Sash1 G A 10: 8,885,871 probably benign Het
Scn9a A G 2: 66,540,635 S534P probably damaging Het
Sec31b C A 19: 44,519,263 V781F probably benign Het
Setd1a C T 7: 127,786,160 L680F possibly damaging Het
Slc10a2 T G 8: 5,089,149 Q265P probably damaging Het
Slc27a1 T A 8: 71,580,664 D283E probably damaging Het
Slc38a4 G A 15: 97,009,071 T262M probably benign Het
Slc52a3 T G 2: 152,004,593 V158G probably benign Het
Stox1 A T 10: 62,664,121 W887R probably damaging Het
Tcap G A 11: 98,384,438 V133M probably benign Het
Tnfrsf12a T C 17: 23,676,214 S87G probably benign Het
Tyr G A 7: 87,493,122 R77C probably damaging Het
Uba6 A G 5: 86,147,073 probably benign Het
Usp24 G A 4: 106,412,213 V2107M probably benign Het
Wdr64 T C 1: 175,717,354 S118P probably damaging Het
Zbtb21 G A 16: 97,951,316 T589I probably damaging Het
Zfp263 G T 16: 3,744,140 probably benign Het
Zfp318 A G 17: 46,412,905 T1945A probably benign Het
Zfp644 G T 5: 106,635,221 R1065S possibly damaging Het
Zfp668 A T 7: 127,867,143 S290T probably damaging Het
Zfp808 T A 13: 62,173,055 D699E probably damaging Het
Other mutations in Ticam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Ticam1 APN 17 56270560 missense possibly damaging 0.80
IGL02164:Ticam1 APN 17 56270019 missense unknown
Lps2 UTSW 17 56271576 small deletion
Pangu UTSW 17 56276693 critical splice donor site probably benign
Yue UTSW 17 56271339 missense probably benign 0.06
R0930:Ticam1 UTSW 17 56270226 missense unknown
R0930:Ticam1 UTSW 17 56271687 missense probably damaging 1.00
R1509:Ticam1 UTSW 17 56271113 missense probably benign 0.43
R1837:Ticam1 UTSW 17 56270799 missense possibly damaging 0.87
R1863:Ticam1 UTSW 17 56271436 missense probably damaging 1.00
R1867:Ticam1 UTSW 17 56271718 missense probably benign 0.01
R1872:Ticam1 UTSW 17 56271897 missense probably benign 0.00
R1893:Ticam1 UTSW 17 56271894 missense probably benign 0.36
R1980:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1981:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1982:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R2263:Ticam1 UTSW 17 56271888 missense possibly damaging 0.95
R2513:Ticam1 UTSW 17 56271612 missense possibly damaging 0.61
R4294:Ticam1 UTSW 17 56271339 missense probably benign 0.06
R4888:Ticam1 UTSW 17 56271642 missense probably damaging 0.98
R4982:Ticam1 UTSW 17 56272020 missense probably benign 0.10
R5396:Ticam1 UTSW 17 56271117 missense probably benign 0.02
R5604:Ticam1 UTSW 17 56271756 missense probably benign 0.13
R5641:Ticam1 UTSW 17 56270629 frame shift probably null
R5647:Ticam1 UTSW 17 56270629 frame shift probably null
R5648:Ticam1 UTSW 17 56270629 frame shift probably null
R5657:Ticam1 UTSW 17 56270629 frame shift probably null
R5770:Ticam1 UTSW 17 56270629 frame shift probably null
R5771:Ticam1 UTSW 17 56270629 frame shift probably null
R5964:Ticam1 UTSW 17 56271703 missense probably damaging 0.99
R5974:Ticam1 UTSW 17 56271178 missense probably benign
R6217:Ticam1 UTSW 17 56270730 missense probably damaging 1.00
R6983:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6984:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6985:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6986:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6987:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6988:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6989:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R7029:Ticam1 UTSW 17 56271154 missense possibly damaging 0.51
R7684:Ticam1 UTSW 17 56269984 missense unknown
R7755:Ticam1 UTSW 17 56270182 missense unknown
R7885:Ticam1 UTSW 17 56271067 missense probably benign 0.04
R8021:Ticam1 UTSW 17 56270089 missense unknown
R8414:Ticam1 UTSW 17 56271340 missense probably benign 0.00
V8831:Ticam1 UTSW 17 56269969 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CACCTCTGGAACGCTAATTTCG -3'
(R):5'- TCGGTGCAGTTCAGATATCAAG -3'

Sequencing Primer
(F):5'- GAACGCTAATTTCGTGTGGTAACCC -3'
(R):5'- AGCCACTCCATTCTCATCAGGG -3'
Posted On2021-04-30