Incidental Mutation 'R9037:Bcar1'
ID687474
Institutional Source Beutler Lab
Gene Symbol Bcar1
Ensembl Gene ENSMUSG00000031955
Gene Namebreast cancer anti-estrogen resistance 1
Synonymsp130Cas, Cas, Crkas
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R9037 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location111710474-111743809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 111720890 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 152 (F152V)
Ref Sequence ENSEMBL: ENSMUSP00000129584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166232] [ENSMUST00000212349]
AlphaFold Q61140
Predicted Effect probably benign
Transcript: ENSMUST00000166232
AA Change: F152V

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129584
Gene: ENSMUSG00000031955
AA Change: F152V

DomainStartEndE-ValueType
SH3 6 64 3e-20 SMART
low complexity region 71 92 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 353 388 N/A INTRINSIC
low complexity region 430 448 N/A INTRINSIC
Pfam:Serine_rich 458 612 9e-49 PFAM
Pfam:DUF3513 658 868 2.1e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212349
AA Change: F152V

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BCAR1, or CAS, is an Src (MIM 190090) family kinase substrate involved in various cellular events, including migration, survival, transformation, and invasion (Sawada et al., 2006 [PubMed 17129785]).[supplied by OMIM, May 2009]
PHENOTYPE: Homozygous null embryos exhibit growth retardation and embryonic lethality, following disruption of cardiac myofibrils, increased vasodilation, and systemic congestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 T A 18: 61,818,995 I432F probably benign Het
Aco2 C G 15: 81,872,419 probably benign Het
Adcy1 A G 11: 7,137,325 T400A possibly damaging Het
Anapc4 C A 5: 52,864,501 Q642K probably benign Het
Ano8 A G 8: 71,484,444 F160S probably damaging Het
Apob T C 12: 8,016,501 V4490A probably benign Het
Cacna2d2 A G 9: 107,509,196 D174G probably benign Het
Capn11 T C 17: 45,639,431 K328R probably benign Het
Coro1a A C 7: 126,700,600 M350R probably benign Het
Ctbp1 T A 5: 33,267,008 M24L probably benign Het
Cyp2c55 T A 19: 39,042,093 F456L probably damaging Het
Dnah5 A T 15: 28,247,958 K747M probably benign Het
Esp36 C T 17: 38,418,949 G60D unknown Het
Gast A G 11: 100,336,610 E43G probably damaging Het
Gm11639 A G 11: 104,912,965 D3048G unknown Het
Gm5849 T G 3: 90,777,848 N10T probably benign Het
Gm8765 A G 13: 50,702,908 K861E probably benign Het
Gulp1 T C 1: 44,754,364 S62P probably benign Het
Hectd1 T C 12: 51,785,882 D903G possibly damaging Het
Hk2 T A 6: 82,743,358 I201F probably benign Het
Ifna2 T C 4: 88,683,427 D118G probably benign Het
Ift172 T C 5: 31,263,056 K1079E possibly damaging Het
Igsf9 T C 1: 172,484,514 V9A probably benign Het
Ints2 G A 11: 86,215,704 T960I probably benign Het
Klk12 T C 7: 43,769,715 W35R probably damaging Het
Ly6c1 C A 15: 75,045,451 G116V probably damaging Het
Macf1 T C 4: 123,471,725 N3081S probably benign Het
Mal2 A G 15: 54,571,543 N12S unknown Het
Mgat1 T G 11: 49,261,429 N246K probably damaging Het
Mpeg1 T A 19: 12,461,826 V216E probably damaging Het
Mtmr9 T A 14: 63,524,083 T541S possibly damaging Het
Olfr1047 G T 2: 86,228,698 T91K probably benign Het
Olfr1246 C T 2: 89,590,707 R136Q probably benign Het
Olfr623 T A 7: 103,661,175 H25L probably benign Het
Olfr995 T C 2: 85,438,795 D121G possibly damaging Het
P2rx6 A G 16: 17,570,443 T328A possibly damaging Het
Pcdhb12 A C 18: 37,436,176 E125A probably benign Het
Pde3a C A 6: 141,471,106 Q569K probably damaging Het
Pepd A T 7: 35,020,973 Q227L probably benign Het
Piezo2 T A 18: 63,092,831 E911D probably benign Het
Pnpla6 A T 8: 3,542,379 R1241* probably null Het
Pold1 T C 7: 44,538,915 D513G probably damaging Het
Polr1d A T 5: 147,078,680 I58L probably benign Het
Ppif T C 14: 25,694,404 L58P probably damaging Het
Preb T C 5: 30,959,246 K101R probably benign Het
Psma8 G T 18: 14,721,194 V44L probably benign Het
Ptf1a A G 2: 19,446,225 Y122C possibly damaging Het
Ranbp6 T C 19: 29,812,917 T12A probably benign Het
Rasal3 C A 17: 32,395,120 R587L probably benign Het
Rnf146 T C 10: 29,347,680 K70R probably benign Het
Serpinb6b G T 13: 32,978,015 E266* probably null Het
Slc15a2 A T 16: 36,762,363 M252K probably benign Het
Slc2a1 T C 4: 119,136,297 F444L probably damaging Het
Sox9 A G 11: 112,784,824 S280G probably damaging Het
Trappc8 A G 18: 20,828,482 V1243A probably benign Het
Trpv2 A T 11: 62,584,405 T215S probably damaging Het
Ttc39a A G 4: 109,442,784 E490G probably damaging Het
Ush2a A T 1: 188,263,290 D86V possibly damaging Het
Usp24 A G 4: 106,379,054 T980A probably damaging Het
Vwa7 T C 17: 35,017,292 V74A probably benign Het
Zan A G 5: 137,454,316 V1501A unknown Het
Zfp105 A G 9: 122,929,771 E169G possibly damaging Het
Zfp788 C T 7: 41,648,891 T317I probably damaging Het
Other mutations in Bcar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Bcar1 APN 8 111711207 missense possibly damaging 0.82
IGL02852:Bcar1 APN 8 111715347 nonsense probably null
R1914:Bcar1 UTSW 8 111715398 missense probably damaging 0.98
R1915:Bcar1 UTSW 8 111715398 missense probably damaging 0.98
R4130:Bcar1 UTSW 8 111714165 missense possibly damaging 0.47
R4249:Bcar1 UTSW 8 111720893 missense probably benign
R4437:Bcar1 UTSW 8 111715389 missense probably damaging 1.00
R4794:Bcar1 UTSW 8 111720920 nonsense probably null
R4937:Bcar1 UTSW 8 111721037 missense probably damaging 0.98
R5402:Bcar1 UTSW 8 111714330 missense probably damaging 1.00
R5951:Bcar1 UTSW 8 111713400 missense probably benign 0.02
R6443:Bcar1 UTSW 8 111715338 missense probably damaging 1.00
R7595:Bcar1 UTSW 8 111720993 missense probably benign 0.01
R8313:Bcar1 UTSW 8 111713638 missense probably benign 0.01
R8373:Bcar1 UTSW 8 111715738 nonsense probably null
RF025:Bcar1 UTSW 8 111714177 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TACCAGGTTGGCCTTACCTTTG -3'
(R):5'- TATGATAAGAAGCCAGTAGGACCTG -3'

Sequencing Primer
(F):5'- GCCTTACCTTTGCCGGTGG -3'
(R):5'- TTCCCCAGGGCGTCCATG -3'
Posted On2021-11-19