Incidental Mutation 'R0747:Mov10'
ID70172
Institutional Source Beutler Lab
Gene Symbol Mov10
Ensembl Gene ENSMUSG00000002227
Gene NameMoloney leukemia virus 10
SynonymsMov-10
MMRRC Submission 038928-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R0747 (G1)
Quality Score208
Status Validated
Chromosome3
Chromosomal Location104794836-104818563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104802496 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 358 (H358L)
Ref Sequence ENSEMBL: ENSMUSP00000002297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002297] [ENSMUST00000106774] [ENSMUST00000106775] [ENSMUST00000136148] [ENSMUST00000166979] [ENSMUST00000168015]
Predicted Effect probably benign
Transcript: ENSMUST00000002297
AA Change: H358L

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000002297
Gene: ENSMUSG00000002227
AA Change: H358L

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106774
SMART Domains Protein: ENSMUSP00000102386
Gene: ENSMUSG00000002227

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106775
AA Change: H431L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102387
Gene: ENSMUSG00000002227
AA Change: H431L

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145414
Predicted Effect probably benign
Transcript: ENSMUST00000166979
AA Change: H431L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000126897
Gene: ENSMUSG00000002227
AA Change: H431L

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
low complexity region 370 385 N/A INTRINSIC
low complexity region 411 426 N/A INTRINSIC
AAA 590 772 5.72e-3 SMART
low complexity region 1026 1043 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168015
AA Change: H358L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000128246
Gene: ENSMUSG00000002227
AA Change: H358L

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196211
Meta Mutation Damage Score 0.0836 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Homozygous knockout is embryonic lethal. Heterozygous knockout leads to reduced dendritic branching of neurons, which affects anxiety- and/or activity-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830406C13Rik T A 14: 12,287,287 M16K probably benign Het
Adam19 A T 11: 46,118,495 probably null Het
Anks4b C T 7: 120,182,163 A139V probably damaging Het
Arf1 G A 11: 59,212,635 R149C probably benign Het
Axl A T 7: 25,764,059 C598S possibly damaging Het
B3gnt2 T C 11: 22,836,316 I291V possibly damaging Het
Ccdc158 T A 5: 92,633,297 H883L probably benign Het
Col6a3 A G 1: 90,802,653 S1644P probably damaging Het
Cspg4 T C 9: 56,890,280 S1343P probably damaging Het
D430041D05Rik G T 2: 104,230,306 H1414Q probably damaging Het
Dnah5 C G 15: 28,444,186 I4043M probably damaging Het
Dnah5 T A 15: 28,444,187 C4044S possibly damaging Het
Dpep3 C T 8: 105,977,386 A267T probably benign Het
Dync1h1 A C 12: 110,612,411 H106P probably benign Het
Dync1h1 A C 12: 110,629,284 E1466A probably damaging Het
Fggy T C 4: 95,812,100 probably benign Het
Frmd6 A G 12: 70,864,056 T5A probably benign Het
Gnb5 G A 9: 75,311,470 V26I probably benign Het
Hephl1 A T 9: 15,054,001 probably benign Het
Hmmr C T 11: 40,721,745 probably benign Het
Hpn A T 7: 31,099,546 F356Y probably damaging Het
Iqgap3 T C 3: 88,107,503 probably benign Het
Ism2 A G 12: 87,285,398 probably benign Het
Kansl1 T A 11: 104,342,976 M754L probably benign Het
Kcnc4 A T 3: 107,448,154 I326N probably damaging Het
Lcn6 G A 2: 25,677,172 V62M probably damaging Het
Lrp1b A T 2: 40,870,341 C2858S probably damaging Het
Lyn G A 4: 3,745,638 probably benign Het
Notch1 A G 2: 26,472,140 V60A unknown Het
Olfr720 C T 14: 14,175,429 A218T probably benign Het
Pgap2 C A 7: 102,237,136 Y176* probably null Het
Pglyrp1 A G 7: 18,890,275 Q161R possibly damaging Het
Plod3 A G 5: 136,988,195 N66S probably benign Het
Psmc3 A G 2: 91,054,300 E18G probably benign Het
Psme3 T G 11: 101,317,046 M9R probably benign Het
Rapgef4 A G 2: 72,223,073 N428S possibly damaging Het
Rbp3 A G 14: 33,956,278 I728V possibly damaging Het
Sall4 A T 2: 168,754,966 H651Q probably damaging Het
Skint3 T A 4: 112,253,905 Y76N probably damaging Het
Slc13a4 T C 6: 35,278,328 T342A probably damaging Het
Slc25a1 G T 16: 17,926,220 T239K probably damaging Het
Slc36a2 T A 11: 55,169,859 I242F probably benign Het
Tekt2 G A 4: 126,323,760 Q171* probably null Het
Tet2 T G 3: 133,467,470 H1677P possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trcg1 C T 9: 57,241,921 P259S probably benign Het
Ttn A C 2: 76,710,598 S25688A probably damaging Het
Vmn2r117 T A 17: 23,475,503 R457* probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Other mutations in Mov10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Mov10 APN 3 104800947 splice site probably benign
IGL01111:Mov10 APN 3 104801405 missense possibly damaging 0.71
IGL01315:Mov10 APN 3 104795945 missense probably damaging 0.98
IGL01463:Mov10 APN 3 104800324 missense probably damaging 1.00
IGL02114:Mov10 APN 3 104795318 unclassified probably benign
IGL02354:Mov10 APN 3 104804121 splice site probably benign
IGL02361:Mov10 APN 3 104804121 splice site probably benign
IGL02692:Mov10 APN 3 104800803 nonsense probably null
IGL03104:Mov10 APN 3 104797307 missense probably damaging 1.00
IGL03121:Mov10 APN 3 104801002 missense probably benign
P0040:Mov10 UTSW 3 104804679 missense probably damaging 1.00
R0025:Mov10 UTSW 3 104804603 missense probably damaging 1.00
R0270:Mov10 UTSW 3 104795405 missense probably benign 0.09
R1434:Mov10 UTSW 3 104795174 missense probably damaging 1.00
R1482:Mov10 UTSW 3 104804546 missense probably damaging 0.98
R1594:Mov10 UTSW 3 104795411 missense probably damaging 1.00
R1656:Mov10 UTSW 3 104799596 missense probably benign 0.03
R1739:Mov10 UTSW 3 104800282 missense probably damaging 0.98
R1785:Mov10 UTSW 3 104818116 missense possibly damaging 0.73
R1786:Mov10 UTSW 3 104818116 missense possibly damaging 0.73
R1911:Mov10 UTSW 3 104801560 splice site probably benign
R1962:Mov10 UTSW 3 104796977 missense probably damaging 1.00
R1993:Mov10 UTSW 3 104799419 missense probably damaging 1.00
R2095:Mov10 UTSW 3 104801531 missense probably damaging 1.00
R2138:Mov10 UTSW 3 104804242 missense probably benign 0.00
R3107:Mov10 UTSW 3 104799724 missense probably damaging 1.00
R4241:Mov10 UTSW 3 104797276 missense probably benign 0.45
R4280:Mov10 UTSW 3 104799779 missense probably damaging 0.98
R4474:Mov10 UTSW 3 104818465 missense probably damaging 1.00
R5227:Mov10 UTSW 3 104802578 missense probably benign
R5391:Mov10 UTSW 3 104802533 missense probably benign 0.12
R5704:Mov10 UTSW 3 104799596 missense probably benign 0.03
R5819:Mov10 UTSW 3 104801512 missense probably damaging 1.00
R5842:Mov10 UTSW 3 104799379 splice site probably benign
R6059:Mov10 UTSW 3 104817950 utr 3 prime probably benign
R6692:Mov10 UTSW 3 104818044 missense probably damaging 0.97
R7226:Mov10 UTSW 3 104801012 missense probably damaging 1.00
R7426:Mov10 UTSW 3 104800052 splice site probably null
R7633:Mov10 UTSW 3 104797065 missense possibly damaging 0.93
R7637:Mov10 UTSW 3 104795885 missense probably benign 0.26
R7869:Mov10 UTSW 3 104804678 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGGAATCTTATCCTGCCTGCTC -3'
(R):5'- TTGAACAGTCCTTGGCACCCAC -3'

Sequencing Primer
(F):5'- TGCCCATACCTTCTGAAATAGG -3'
(R):5'- TCAATCTGGGGATGATTGAACC -3'
Posted On2013-09-30