Incidental Mutation 'R7637:Mov10'
ID590003
Institutional Source Beutler Lab
Gene Symbol Mov10
Ensembl Gene ENSMUSG00000002227
Gene NameMoloney leukemia virus 10
SynonymsMov-10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R7637 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location104794836-104818563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104795885 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 896 (N896S)
Ref Sequence ENSEMBL: ENSMUSP00000128246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002297] [ENSMUST00000002303] [ENSMUST00000106774] [ENSMUST00000106775] [ENSMUST00000106787] [ENSMUST00000166979] [ENSMUST00000168015] [ENSMUST00000176347] [ENSMUST00000196817] [ENSMUST00000199824]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002297
AA Change: N896S

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000002297
Gene: ENSMUSG00000002227
AA Change: N896S

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000002303
SMART Domains Protein: ENSMUSP00000002303
Gene: ENSMUSG00000002233

DomainStartEndE-ValueType
RHO 8 181 9.45e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106774
SMART Domains Protein: ENSMUSP00000102386
Gene: ENSMUSG00000002227

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106775
AA Change: N969S

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102387
Gene: ENSMUSG00000002227
AA Change: N969S

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106787
SMART Domains Protein: ENSMUSP00000102399
Gene: ENSMUSG00000002233

DomainStartEndE-ValueType
RHO 8 181 9.45e-130 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166979
AA Change: N969S

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126897
Gene: ENSMUSG00000002227
AA Change: N969S

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
low complexity region 370 385 N/A INTRINSIC
low complexity region 411 426 N/A INTRINSIC
AAA 590 772 5.72e-3 SMART
low complexity region 1026 1043 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168015
AA Change: N896S

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128246
Gene: ENSMUSG00000002227
AA Change: N896S

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176347
SMART Domains Protein: ENSMUSP00000135659
Gene: ENSMUSG00000002233

DomainStartEndE-ValueType
RHO 8 148 7.45e-87 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196817
SMART Domains Protein: ENSMUSP00000142697
Gene: ENSMUSG00000002233

DomainStartEndE-ValueType
RHO 8 181 9.45e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199824
SMART Domains Protein: ENSMUSP00000142855
Gene: ENSMUSG00000002233

DomainStartEndE-ValueType
RHO 8 118 1.4e-68 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Homozygous knockout is embryonic lethal. Heterozygous knockout leads to reduced dendritic branching of neurons, which affects anxiety- and/or activity-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,218,952 Q651L probably benign Het
Adam8 C T 7: 139,985,430 V624I probably damaging Het
Ccdc144b T A 3: 36,046,876 Q49L probably damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Cmya5 T C 13: 93,083,212 K3243R possibly damaging Het
Dock5 G A 14: 67,786,340 T1124M possibly damaging Het
Fam8a1 A T 13: 46,671,247 M237L probably benign Het
Fars2 G T 13: 36,204,775 K82N probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm5767 C T 16: 8,683,646 P59L unknown Het
Gnat3 A G 5: 18,003,772 D158G Het
Grhl2 A C 15: 37,328,330 N400T probably damaging Het
Grin2c A T 11: 115,256,259 probably null Het
Hipk4 A G 7: 27,523,548 Y11C probably damaging Het
Hspa9 G T 18: 34,938,687 A620E not run Het
Igkv12-89 A G 6: 68,835,099 S29P probably benign Het
Itga8 A T 2: 12,109,187 D1039E probably damaging Het
Itgae A T 11: 73,113,631 D248V probably damaging Het
Kmt2c T C 5: 25,315,095 K2006E probably damaging Het
Mdga1 C T 17: 29,832,379 G934R probably benign Het
Ndufb6 A T 4: 40,273,080 probably null Het
Nlk T C 11: 78,591,005 probably null Het
Notch2 T A 3: 98,146,623 S2201T probably damaging Het
Olfr152 A T 2: 87,783,434 D298V probably damaging Het
Pank1 A C 19: 34,821,988 probably null Het
Pdlim3 T C 8: 45,909,065 F126S probably damaging Het
Pds5a C A 5: 65,638,604 G648C probably benign Het
Plekhh3 T C 11: 101,164,327 I567V unknown Het
Ppfia2 T C 10: 106,865,403 probably null Het
Prl3d1 A G 13: 27,100,069 D207G probably damaging Het
Prss23 T A 7: 89,510,246 D205V probably benign Het
Pygl C T 12: 70,197,795 probably null Het
Qsox2 A G 2: 26,221,020 F111S probably damaging Het
Sart3 T C 5: 113,771,352 N95S probably benign Het
Scpep1 A G 11: 88,929,220 F414S probably damaging Het
Selenbp1 C A 3: 94,937,348 Y105* probably null Het
Sirpa A G 2: 129,616,445 D327G probably benign Het
Sowahc G A 10: 59,222,183 R47H probably damaging Het
Szt2 T C 4: 118,393,828 Y361C probably damaging Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tie1 T C 4: 118,472,978 I1042M probably damaging Het
Tmem132e T A 11: 82,434,516 L114Q probably damaging Het
Tmx3 A G 18: 90,537,109 T317A probably damaging Het
Tppp3 A G 8: 105,468,292 V69A probably benign Het
Tpr T C 1: 150,423,516 Y1156H probably damaging Het
Trank1 A C 9: 111,365,296 D796A possibly damaging Het
Tsc2 G A 17: 24,607,492 P928S probably benign Het
Unc80 G T 1: 66,672,684 V2722F possibly damaging Het
Vmn1r199 G T 13: 22,382,675 L46F probably benign Het
Vps13a A T 19: 16,750,149 H196Q probably benign Het
Wnt10a T A 1: 74,793,474 C75* probably null Het
Zfp335 A G 2: 164,892,539 probably null Het
Other mutations in Mov10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Mov10 APN 3 104800947 splice site probably benign
IGL01111:Mov10 APN 3 104801405 missense possibly damaging 0.71
IGL01315:Mov10 APN 3 104795945 missense probably damaging 0.98
IGL01463:Mov10 APN 3 104800324 missense probably damaging 1.00
IGL02114:Mov10 APN 3 104795318 unclassified probably benign
IGL02354:Mov10 APN 3 104804121 splice site probably benign
IGL02361:Mov10 APN 3 104804121 splice site probably benign
IGL02692:Mov10 APN 3 104800803 nonsense probably null
IGL03104:Mov10 APN 3 104797307 missense probably damaging 1.00
IGL03121:Mov10 APN 3 104801002 missense probably benign
P0040:Mov10 UTSW 3 104804679 missense probably damaging 1.00
R0025:Mov10 UTSW 3 104804603 missense probably damaging 1.00
R0270:Mov10 UTSW 3 104795405 missense probably benign 0.09
R0747:Mov10 UTSW 3 104802496 missense probably benign 0.41
R1434:Mov10 UTSW 3 104795174 missense probably damaging 1.00
R1482:Mov10 UTSW 3 104804546 missense probably damaging 0.98
R1594:Mov10 UTSW 3 104795411 missense probably damaging 1.00
R1656:Mov10 UTSW 3 104799596 missense probably benign 0.03
R1739:Mov10 UTSW 3 104800282 missense probably damaging 0.98
R1785:Mov10 UTSW 3 104818116 missense possibly damaging 0.73
R1786:Mov10 UTSW 3 104818116 missense possibly damaging 0.73
R1911:Mov10 UTSW 3 104801560 splice site probably benign
R1962:Mov10 UTSW 3 104796977 missense probably damaging 1.00
R1993:Mov10 UTSW 3 104799419 missense probably damaging 1.00
R2095:Mov10 UTSW 3 104801531 missense probably damaging 1.00
R2138:Mov10 UTSW 3 104804242 missense probably benign 0.00
R3107:Mov10 UTSW 3 104799724 missense probably damaging 1.00
R4241:Mov10 UTSW 3 104797276 missense probably benign 0.45
R4280:Mov10 UTSW 3 104799779 missense probably damaging 0.98
R4474:Mov10 UTSW 3 104818465 missense probably damaging 1.00
R5227:Mov10 UTSW 3 104802578 missense probably benign
R5391:Mov10 UTSW 3 104802533 missense probably benign 0.12
R5704:Mov10 UTSW 3 104799596 missense probably benign 0.03
R5819:Mov10 UTSW 3 104801512 missense probably damaging 1.00
R5842:Mov10 UTSW 3 104799379 splice site probably benign
R6059:Mov10 UTSW 3 104817950 utr 3 prime probably benign
R6692:Mov10 UTSW 3 104818044 missense probably damaging 0.97
R7226:Mov10 UTSW 3 104801012 missense probably damaging 1.00
R7426:Mov10 UTSW 3 104800052 splice site probably null
R7633:Mov10 UTSW 3 104797065 missense possibly damaging 0.93
R7869:Mov10 UTSW 3 104804678 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTTTTCCAGTCTGGGTCG -3'
(R):5'- AAGTACCCAGTGTCTTGTCTGTAC -3'

Sequencing Primer
(F):5'- CAGTCTGGGTCGTGGCCTAG -3'
(R):5'- AGCTTTGTCCCCTAGAGCAG -3'
Posted On2019-10-24