Incidental Mutation 'R9303:Casq2'
ID 705051
Institutional Source Beutler Lab
Gene Symbol Casq2
Ensembl Gene ENSMUSG00000027861
Gene Name calsequestrin 2
Synonyms ESTM52, cCSQ, cardiac calsequestrin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9303 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 102086415-102146514 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102145384 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 404 (D404G)
Ref Sequence ENSEMBL: ENSMUSP00000130482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029454] [ENSMUST00000164123] [ENSMUST00000165540]
AlphaFold O09161
Predicted Effect unknown
Transcript: ENSMUST00000029454
AA Change: D401G
SMART Domains Protein: ENSMUSP00000029454
Gene: ENSMUSG00000027861
AA Change: D401G

DomainStartEndE-ValueType
Pfam:Calsequestrin 1 382 1.4e-226 PFAM
Pfam:Thioredoxin_6 171 364 7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164123
SMART Domains Protein: ENSMUSP00000131232
Gene: ENSMUSG00000027861

DomainStartEndE-ValueType
Pfam:Calsequestrin 2 108 1.3e-46 PFAM
Pfam:Thioredoxin_6 101 293 6.1e-20 PFAM
Pfam:Calsequestrin 106 311 1.9e-127 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000165540
AA Change: D404G
SMART Domains Protein: ENSMUSP00000130482
Gene: ENSMUSG00000027861
AA Change: D404G

DomainStartEndE-ValueType
Pfam:Calsequestrin 1 386 7.4e-224 PFAM
Pfam:Thioredoxin_6 171 367 9.1e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene specifies the cardiac muscle family member of the calsequestrin family. Calsequestrin is localized to the sarcoplasmic reticulum in cardiac and slow skeletal muscle cells. The protein is a calcium binding protein that stores calcium for muscle function. Mutations in this gene cause stress-induced polymorphic ventricular tachycardia, also referred to as catecholaminergic polymorphic ventricular tachycardia 2 (CPVT2), a disease characterized by bidirectional ventricular tachycardia that may lead to cardiac arrest. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene cause impaired intracellular calcium regulation in cardiac myocytes and lead to an arrhythmogenic syndrome called catecholaminergic polymorphic ventricular tachycardia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,500,305 C219* probably null Het
4932438A13Rik A G 3: 37,044,820 I1277V Het
Abca16 A G 7: 120,527,766 I1227V probably benign Het
Adamts17 T C 7: 66,839,897 L21P probably damaging Het
Adcy1 T C 11: 7,144,766 V564A probably damaging Het
Adgre1 A G 17: 57,441,275 N492D probably benign Het
Aldh1b1 G A 4: 45,803,811 V450M probably damaging Het
Arv1 T A 8: 124,730,946 H196Q probably damaging Het
Atp9a A T 2: 168,675,243 I390N probably benign Het
Capn10 T C 1: 92,943,943 probably null Het
Cenpf T C 1: 189,660,074 probably null Het
Cep295nl G A 11: 118,333,940 P26L possibly damaging Het
Chmp4c T G 3: 10,389,914 S214A probably benign Het
Chrna5 T C 9: 55,004,872 F319L probably benign Het
Csmd1 G T 8: 15,961,532 T2507K probably benign Het
Ctnnd2 T C 15: 30,966,891 M996T probably damaging Het
Dbf4 T C 5: 8,398,102 T328A unknown Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Fat1 T A 8: 45,010,461 W1347R probably damaging Het
Fbxw21 A G 9: 109,157,659 F51L probably benign Het
Gm498 G T 7: 143,881,165 probably null Het
Gng2 G T 14: 19,875,893 H44N probably damaging Het
Hps5 G A 7: 46,789,195 T38I possibly damaging Het
Igf2 G A 7: 142,654,416 R64C probably damaging Het
Inpp4b C T 8: 82,033,129 A601V probably damaging Het
Kdm2a A G 19: 4,345,578 Y342H probably benign Het
Kidins220 C A 12: 25,057,111 T1430K probably benign Het
Knl1 T C 2: 119,068,348 C177R possibly damaging Het
Krt32 T C 11: 100,081,203 T440A probably benign Het
Kynu T A 2: 43,679,756 F350Y probably damaging Het
Lama4 T C 10: 39,097,141 L1568P probably damaging Het
Lrp1b A T 2: 41,728,562 S281T Het
Olfr131 A T 17: 38,082,738 V80D probably damaging Het
Olfr191 A G 16: 59,086,439 S15P probably benign Het
Olfr897-ps1 C T 9: 38,309,167 T124M probably benign Het
Orc3 G A 4: 34,607,181 R50* probably null Het
Osbpl6 T A 2: 76,548,372 D124E probably damaging Het
Parp4 TG T 14: 56,595,333 probably null Het
Parp4 T C 14: 56,614,767 probably null Het
Pcdhb18 A C 18: 37,491,951 H778P probably benign Het
Polg A T 7: 79,456,112 Y710N probably benign Het
Ppp2r2b C A 18: 42,645,960 R370L possibly damaging Het
Raet1e C T 10: 22,181,973 T213I possibly damaging Het
Reln T A 5: 21,988,707 S1418C possibly damaging Het
Reln T C 5: 22,080,691 S427G probably benign Het
Rhobtb2 G A 14: 69,787,927 H633Y probably damaging Het
Serpina3i T C 12: 104,268,622 V404A probably damaging Het
Serpinb8 T C 1: 107,599,039 probably null Het
Sorl1 G T 9: 41,989,443 Q1658K probably damaging Het
Tmem26 G A 10: 68,723,986 W29* probably null Het
Togaram2 A G 17: 71,689,413 E137G probably damaging Het
Ttc39b A G 4: 83,232,786 L524S probably damaging Het
Usp43 T C 11: 67,876,519 N675S probably damaging Het
Vmn2r104 A G 17: 20,048,177 L10P possibly damaging Het
Zbtb1 G A 12: 76,385,999 R253Q probably damaging Het
Zfp354b T A 11: 50,929,429 R36S probably damaging Het
Other mutations in Casq2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Casq2 APN 3 102110231 splice site probably benign
IGL02597:Casq2 APN 3 102126637 missense probably damaging 1.00
IGL02863:Casq2 APN 3 102144175 missense possibly damaging 0.84
IGL02902:Casq2 APN 3 102086797 nonsense probably null
IGL03176:Casq2 APN 3 102126654 missense possibly damaging 0.50
R0126:Casq2 UTSW 3 102133399 missense probably damaging 1.00
R0653:Casq2 UTSW 3 102113166 critical splice donor site probably null
R1036:Casq2 UTSW 3 102142215 missense probably damaging 1.00
R1052:Casq2 UTSW 3 102144234 splice site probably null
R1158:Casq2 UTSW 3 102116883 missense probably damaging 1.00
R2886:Casq2 UTSW 3 102144218 missense probably damaging 1.00
R3001:Casq2 UTSW 3 102145201 missense probably damaging 0.99
R3002:Casq2 UTSW 3 102145201 missense probably damaging 0.99
R4155:Casq2 UTSW 3 102133102 splice site probably null
R4715:Casq2 UTSW 3 102110244 missense probably benign 0.00
R6013:Casq2 UTSW 3 102145629 splice site probably null
R6778:Casq2 UTSW 3 102127931 splice site probably null
R6836:Casq2 UTSW 3 102086760 missense probably damaging 1.00
R6844:Casq2 UTSW 3 102110262 missense possibly damaging 0.70
R7055:Casq2 UTSW 3 102142245 missense probably damaging 1.00
R7638:Casq2 UTSW 3 102086700 missense possibly damaging 0.73
R7761:Casq2 UTSW 3 102145264 missense probably damaging 1.00
R7997:Casq2 UTSW 3 102086842 missense probably damaging 0.98
R8169:Casq2 UTSW 3 102110312 missense possibly damaging 0.69
R9060:Casq2 UTSW 3 102145303 missense unknown
R9305:Casq2 UTSW 3 102145384 missense unknown
R9600:Casq2 UTSW 3 102145306 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCTCATTGCAGGCTGACAG -3'
(R):5'- AATGTACCACTCCTGCCAAG -3'

Sequencing Primer
(F):5'- CTCATTGCAGGCTGACAGTATCTG -3'
(R):5'- TGTACCACTCCTGCCAAGAACAG -3'
Posted On 2022-03-25