Incidental Mutation 'R9303:Adgre1'
ID 705092
Institutional Source Beutler Lab
Gene Symbol Adgre1
Ensembl Gene ENSMUSG00000004730
Gene Name adhesion G protein-coupled receptor E1
Synonyms Emr1, EGF-TM7, F4/80, DD7A5-7, TM7LN3, Ly71
Accession Numbers

Ncbi RefSeq: NM_010130.4 ;MGI:106912

Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock # R9303 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 57358686-57483529 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57441275 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 492 (N492D)
Ref Sequence ENSEMBL: ENSMUSP00000004850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004850] [ENSMUST00000086763]
AlphaFold Q61549
Predicted Effect probably benign
Transcript: ENSMUST00000004850
AA Change: N492D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: N492D

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086763
AA Change: N492D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: N492D

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
MGI Phenotype Strain: 3582333
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,500,305 C219* probably null Het
4932438A13Rik A G 3: 37,044,820 I1277V Het
Abca16 A G 7: 120,527,766 I1227V probably benign Het
Adamts17 T C 7: 66,839,897 L21P probably damaging Het
Adcy1 T C 11: 7,144,766 V564A probably damaging Het
Aldh1b1 G A 4: 45,803,811 V450M probably damaging Het
Arv1 T A 8: 124,730,946 H196Q probably damaging Het
Atp9a A T 2: 168,675,243 I390N probably benign Het
Capn10 T C 1: 92,943,943 probably null Het
Casq2 A G 3: 102,145,384 D404G unknown Het
Cenpf T C 1: 189,660,074 probably null Het
Cep295nl G A 11: 118,333,940 P26L possibly damaging Het
Chmp4c T G 3: 10,389,914 S214A probably benign Het
Chrna5 T C 9: 55,004,872 F319L probably benign Het
Csmd1 G T 8: 15,961,532 T2507K probably benign Het
Ctnnd2 T C 15: 30,966,891 M996T probably damaging Het
Dbf4 T C 5: 8,398,102 T328A unknown Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Fat1 T A 8: 45,010,461 W1347R probably damaging Het
Fbxw21 A G 9: 109,157,659 F51L probably benign Het
Gm498 G T 7: 143,881,165 probably null Het
Gng2 G T 14: 19,875,893 H44N probably damaging Het
Hps5 G A 7: 46,789,195 T38I possibly damaging Het
Igf2 G A 7: 142,654,416 R64C probably damaging Het
Inpp4b C T 8: 82,033,129 A601V probably damaging Het
Kdm2a A G 19: 4,345,578 Y342H probably benign Het
Kidins220 C A 12: 25,057,111 T1430K probably benign Het
Knl1 T C 2: 119,068,348 C177R possibly damaging Het
Krt32 T C 11: 100,081,203 T440A probably benign Het
Kynu T A 2: 43,679,756 F350Y probably damaging Het
Lama4 T C 10: 39,097,141 L1568P probably damaging Het
Lrp1b A T 2: 41,728,562 S281T Het
Olfr131 A T 17: 38,082,738 V80D probably damaging Het
Olfr191 A G 16: 59,086,439 S15P probably benign Het
Olfr897-ps1 C T 9: 38,309,167 T124M probably benign Het
Orc3 G A 4: 34,607,181 R50* probably null Het
Osbpl6 T A 2: 76,548,372 D124E probably damaging Het
Parp4 TG T 14: 56,595,333 probably null Het
Parp4 T C 14: 56,614,767 probably null Het
Pcdhb18 A C 18: 37,491,951 H778P probably benign Het
Polg A T 7: 79,456,112 Y710N probably benign Het
Ppp2r2b C A 18: 42,645,960 R370L possibly damaging Het
Raet1e C T 10: 22,181,973 T213I possibly damaging Het
Reln T A 5: 21,988,707 S1418C possibly damaging Het
Reln T C 5: 22,080,691 S427G probably benign Het
Rhobtb2 G A 14: 69,787,927 H633Y probably damaging Het
Serpina3i T C 12: 104,268,622 V404A probably damaging Het
Serpinb8 T C 1: 107,599,039 probably null Het
Sorl1 G T 9: 41,989,443 Q1658K probably damaging Het
Tmem26 G A 10: 68,723,986 W29* probably null Het
Togaram2 A G 17: 71,689,413 E137G probably damaging Het
Ttc39b A G 4: 83,232,786 L524S probably damaging Het
Usp43 T C 11: 67,876,519 N675S probably damaging Het
Vmn2r104 A G 17: 20,048,177 L10P possibly damaging Het
Zbtb1 G A 12: 76,385,999 R253Q probably damaging Het
Zfp354b T A 11: 50,929,429 R36S probably damaging Het
Other mutations in Adgre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgre1 APN 17 57450055 missense probably benign 0.00
IGL00966:Adgre1 APN 17 57419335 missense probably benign 0.04
IGL01680:Adgre1 APN 17 57402620 missense unknown
IGL01724:Adgre1 APN 17 57444064 nonsense probably null
IGL02172:Adgre1 APN 17 57478879 missense probably damaging 1.00
IGL02260:Adgre1 APN 17 57447891 missense probably benign 0.01
IGL02272:Adgre1 APN 17 57450021 nonsense probably null
IGL02336:Adgre1 APN 17 57411024 nonsense probably null
IGL02346:Adgre1 APN 17 57443919 missense probably benign 0.15
IGL02398:Adgre1 APN 17 57402824 nonsense probably null
IGL02618:Adgre1 APN 17 57444021 missense possibly damaging 0.66
IGL02690:Adgre1 APN 17 57480921 missense probably damaging 1.00
IGL02936:Adgre1 APN 17 57478833 missense probably benign 0.26
IGL03112:Adgre1 APN 17 57448029 splice site probably null
IGL03350:Adgre1 APN 17 57401908 missense probably benign 0.16
F480 UTSW 17 57444063 missense probably damaging 1.00
lomax UTSW 17 57402811 missense unknown
Onion UTSW 17 57402841 nonsense probably null
Scallion UTSW 17 57401977 missense possibly damaging 0.90
R0049:Adgre1 UTSW 17 57402841 nonsense probably null
R0153:Adgre1 UTSW 17 57443939 missense possibly damaging 0.92
R0277:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0278:Adgre1 UTSW 17 57447872 missense probably benign 0.07
R0323:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0389:Adgre1 UTSW 17 57406839 missense possibly damaging 0.80
R0492:Adgre1 UTSW 17 57402742 missense unknown
R0621:Adgre1 UTSW 17 57441359 missense probably damaging 0.98
R0647:Adgre1 UTSW 17 57411003 missense probably damaging 1.00
R1310:Adgre1 UTSW 17 57447936 missense probably benign 0.00
R1601:Adgre1 UTSW 17 57441353 missense probably benign 0.01
R1689:Adgre1 UTSW 17 57449921 missense probably benign 0.31
R1708:Adgre1 UTSW 17 57401974 missense possibly damaging 0.93
R1796:Adgre1 UTSW 17 57441350 missense probably benign 0.43
R1839:Adgre1 UTSW 17 57441299 missense probably benign 0.00
R1860:Adgre1 UTSW 17 57441363 missense probably benign 0.00
R2165:Adgre1 UTSW 17 57419338 missense probably damaging 0.97
R2219:Adgre1 UTSW 17 57401912 missense possibly damaging 0.92
R2519:Adgre1 UTSW 17 57410956 missense probably damaging 1.00
R3874:Adgre1 UTSW 17 57401925 missense probably benign 0.08
R3911:Adgre1 UTSW 17 57447860 missense probably damaging 1.00
R4190:Adgre1 UTSW 17 57402811 missense unknown
R4439:Adgre1 UTSW 17 57447954 missense probably damaging 1.00
R4513:Adgre1 UTSW 17 57410947 missense probably benign 0.34
R4529:Adgre1 UTSW 17 57420519 missense possibly damaging 0.92
R4543:Adgre1 UTSW 17 57406874 missense probably benign 0.07
R4610:Adgre1 UTSW 17 57450073 missense possibly damaging 0.50
R4665:Adgre1 UTSW 17 57480947 missense probably benign 0.20
R4911:Adgre1 UTSW 17 57447832 missense possibly damaging 0.57
R4928:Adgre1 UTSW 17 57444064 nonsense probably null
R4942:Adgre1 UTSW 17 57406903 missense probably damaging 1.00
R4946:Adgre1 UTSW 17 57443918 missense probably benign 0.33
R4953:Adgre1 UTSW 17 57441321 missense probably damaging 0.99
R5107:Adgre1 UTSW 17 57401977 missense possibly damaging 0.90
R5366:Adgre1 UTSW 17 57402817 missense probably benign 0.39
R5590:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R5619:Adgre1 UTSW 17 57420437 missense probably benign 0.15
R5699:Adgre1 UTSW 17 57481007 missense probably benign 0.43
R5734:Adgre1 UTSW 17 57443990 missense probably benign 0.00
R5860:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6149:Adgre1 UTSW 17 57445018 missense probably benign 0.08
R6478:Adgre1 UTSW 17 57401955 missense possibly damaging 0.81
R6709:Adgre1 UTSW 17 57406917 missense probably benign 0.10
R6864:Adgre1 UTSW 17 57478879 missense probably damaging 1.00
R6945:Adgre1 UTSW 17 57410844 missense probably benign 0.01
R6945:Adgre1 UTSW 17 57420399 missense probably benign 0.39
R6988:Adgre1 UTSW 17 57408445 missense probably benign 0.00
R7019:Adgre1 UTSW 17 57410945 missense probably damaging 0.98
R7154:Adgre1 UTSW 17 57444087 splice site probably null
R7347:Adgre1 UTSW 17 57420441 missense probably damaging 1.00
R7459:Adgre1 UTSW 17 57449933 missense probably damaging 1.00
R7709:Adgre1 UTSW 17 57402519 missense unknown
R7939:Adgre1 UTSW 17 57449938 missense probably damaging 0.98
R7977:Adgre1 UTSW 17 57447987 missense possibly damaging 0.54
R7987:Adgre1 UTSW 17 57447987 missense possibly damaging 0.54
R8187:Adgre1 UTSW 17 57420349 missense probably benign 0.00
R8210:Adgre1 UTSW 17 57445061 missense possibly damaging 0.94
R8223:Adgre1 UTSW 17 57361692 missense probably damaging 0.99
R8344:Adgre1 UTSW 17 57408459 missense probably benign 0.12
R8698:Adgre1 UTSW 17 57402003 missense probably benign 0.05
R9236:Adgre1 UTSW 17 57402782 nonsense probably null
R9262:Adgre1 UTSW 17 57447941 missense probably damaging 1.00
R9305:Adgre1 UTSW 17 57441275 missense probably benign 0.00
R9605:Adgre1 UTSW 17 57411083 missense probably benign 0.00
R9661:Adgre1 UTSW 17 57441368 missense possibly damaging 0.70
R9678:Adgre1 UTSW 17 57443997 missense probably damaging 0.96
R9751:Adgre1 UTSW 17 57450101 missense probably null 0.06
R9785:Adgre1 UTSW 17 57478930 missense probably damaging 1.00
Z1176:Adgre1 UTSW 17 57361729 missense possibly damaging 0.76
Z1177:Adgre1 UTSW 17 57419374 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGATGATCTCCCCATTCCAGT -3'
(R):5'- GCTGCCTGTACATAGAGCCA -3'

Sequencing Primer
(F):5'- CCCCTGTTCACTCATGATGTC -3'
(R):5'- GCCTGTACATAGAGCCATCTGC -3'
Posted On 2022-03-25