Incidental Mutation 'R9350:Adarb1'
ID 708027
Institutional Source Beutler Lab
Gene Symbol Adarb1
Ensembl Gene ENSMUSG00000020262
Gene Name adenosine deaminase, RNA-specific, B1
Synonyms RED1, D10Bwg0447e, ADAR2, 1700057H01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9350 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 77290726-77418270 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 77322433 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 60 (N60I)
Ref Sequence ENSEMBL: ENSMUSP00000095976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020496] [ENSMUST00000098374] [ENSMUST00000105404] [ENSMUST00000105406] [ENSMUST00000126073] [ENSMUST00000144547]
AlphaFold Q91ZS8
Predicted Effect probably damaging
Transcript: ENSMUST00000020496
AA Change: N60I

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020496
Gene: ENSMUSG00000020262
AA Change: N60I

DomainStartEndE-ValueType
DSRM 79 143 1.9e-22 SMART
low complexity region 192 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
DSRM 236 297 5.8e-21 SMART
ADEAMc 322 698 2.1e-196 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098374
AA Change: N60I

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095976
Gene: ENSMUSG00000020262
AA Change: N60I

DomainStartEndE-ValueType
DSRM 79 143 3.31e-20 SMART
low complexity region 192 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
DSRM 236 297 9.87e-19 SMART
ADEAMc 322 708 1.32e-191 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105404
AA Change: M76L
Predicted Effect possibly damaging
Transcript: ENSMUST00000105406
AA Change: N60I

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101046
Gene: ENSMUSG00000020262
AA Change: N60I

DomainStartEndE-ValueType
DSRM 79 143 3.31e-20 SMART
low complexity region 192 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
DSRM 236 297 9.87e-19 SMART
ADEAMc 322 708 1.32e-191 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126073
Predicted Effect unknown
Transcript: ENSMUST00000144547
AA Change: M76L
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a double-stranded-RNA-specific adenosine deaminase that is involved in editing pre-mRNAs by site-specific conversion of adenosine (A) to inosine (I). Substrates for this enzyme include ionotropic glutamate receptors (GluR2-6) and serotonin receptor (5HT2C). Studies in rodents have shown that this protein can modify its own pre-mRNA by A->I editing to create a novel acceptor splice site, alternative splicing to which results in down regulation of its protein expression. Additional splicing events result in transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in progressive seizure susceptibility and death within 20 days of age. Mice homozygous for a conditional allele activated in neurons exhibit motor neuron degeneration, motor function abnormalities, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T A 8: 43,569,632 M274L probably benign Het
Adgrv1 T A 13: 81,506,155 N2919I probably damaging Het
Adora3 C T 3: 105,907,297 T121M possibly damaging Het
Arhgap19 A T 19: 41,773,127 F466Y probably benign Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Atxn7l1 C T 12: 33,367,316 T492I probably benign Het
B3galnt2 T C 13: 13,995,808 S248P probably damaging Het
Casp2 T C 6: 42,269,398 V230A probably benign Het
Creb3l1 C T 2: 91,991,886 probably null Het
Ctnnbl1 G A 2: 157,809,525 G240E possibly damaging Het
Dennd2c T C 3: 103,131,992 L152P possibly damaging Het
Dhx16 T A 17: 35,889,311 F874Y probably damaging Het
Dnah14 A T 1: 181,734,804 Y2643F possibly damaging Het
Dnah2 C A 11: 69,493,247 V1048L probably benign Het
Dnah7a T C 1: 53,397,148 I4012V probably benign Het
Duox2 G A 2: 122,285,248 R1002* probably null Het
Ears2 T A 7: 122,044,563 K391* probably null Het
Eif4e T C 3: 138,553,709 V176A probably benign Het
Erbb4 T A 1: 68,290,479 I626L probably benign Het
Fam171a1 C T 2: 3,225,000 T390I probably benign Het
Fam187b A G 7: 30,977,612 E182G possibly damaging Het
Fam204a A G 19: 60,221,253 V15A probably benign Het
Fscn3 C T 6: 28,430,433 R201* probably null Het
Fzd6 A G 15: 39,031,648 D403G probably damaging Het
Gars G A 6: 55,052,264 A210T probably null Het
Gmcl1 A T 6: 86,700,587 I428N probably damaging Het
Gmip T A 8: 69,811,182 I92N probably damaging Het
Il17rc G A 6: 113,479,087 V298I probably damaging Het
Kifap3 A G 1: 163,783,061 I37V probably benign Het
Marf1 T C 16: 14,145,925 K505E probably damaging Het
Masp2 A T 4: 148,607,939 probably null Het
Mmp15 G A 8: 95,366,374 R127H probably damaging Het
Nrd1 A G 4: 109,032,461 T402A possibly damaging Het
Olfr731 T A 14: 50,237,950 I312L probably benign Het
Olfr934 A T 9: 38,982,785 N86K probably benign Het
Papln A T 12: 83,786,864 I1185F probably damaging Het
Pcdhgb1 A G 18: 37,681,652 N399D probably benign Het
Pcdhgb6 T A 18: 37,743,819 S527T probably benign Het
Phkb T A 8: 86,016,864 Y530* probably null Het
Pira2 A G 7: 3,841,031 S581P probably benign Het
Pou4f3 A T 18: 42,395,264 T91S probably benign Het
Prpf38a A G 4: 108,566,915 S296P unknown Het
Rnf213 T C 11: 119,442,149 V2729A Het
Rtl1 G A 12: 109,590,792 Q1538* probably null Het
Sars2 T C 7: 28,747,848 S224P probably damaging Het
Senp8 A G 9: 59,737,822 V17A probably benign Het
Serpinb13 T A 1: 106,995,832 L89* probably null Het
Sh3bp2 T A 5: 34,561,109 probably null Het
Shank2 A G 7: 144,407,208 T254A probably benign Het
Smdt1 A T 15: 82,347,303 E12D probably benign Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Svs1 A T 6: 48,988,326 N423Y probably damaging Het
Taar2 A G 10: 23,941,447 N295S probably damaging Het
Trim24 A G 6: 37,915,273 Q247R probably damaging Het
Trpc4 T A 3: 54,302,189 N658K probably damaging Het
Ube2e1 T C 14: 18,284,348 D137G probably damaging Het
Ubn1 T A 16: 5,081,558 H1055Q probably benign Het
Vmn1r235 A G 17: 21,261,928 T172A probably benign Het
Vps13d A G 4: 145,155,763 F1087L Het
Xirp2 T C 2: 67,519,309 S3283P probably damaging Het
Zeb2 C A 2: 44,997,146 S633I possibly damaging Het
Other mutations in Adarb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Adarb1 APN 10 77322490 missense probably damaging 1.00
IGL01996:Adarb1 APN 10 77322217 missense probably damaging 1.00
IGL02173:Adarb1 APN 10 77321825 missense probably damaging 1.00
IGL02214:Adarb1 APN 10 77322301 missense probably damaging 0.99
IGL02399:Adarb1 APN 10 77295754 missense probably benign 0.02
IGL02699:Adarb1 APN 10 77322019 missense probably benign
IGL02867:Adarb1 APN 10 77313541 missense probably benign 0.01
IGL02889:Adarb1 APN 10 77313541 missense probably benign 0.01
IGL03133:Adarb1 APN 10 77325896 start gained probably benign
R1806:Adarb1 UTSW 10 77322265 missense probably damaging 0.98
R1834:Adarb1 UTSW 10 77317231 splice site probably benign
R2174:Adarb1 UTSW 10 77295798 missense probably benign 0.35
R2233:Adarb1 UTSW 10 77317349 missense probably damaging 1.00
R2234:Adarb1 UTSW 10 77317349 missense probably damaging 1.00
R2908:Adarb1 UTSW 10 77313403 critical splice donor site probably null
R3106:Adarb1 UTSW 10 77321757 missense probably damaging 1.00
R5104:Adarb1 UTSW 10 77322287 missense probably damaging 1.00
R5134:Adarb1 UTSW 10 77325845 intron probably benign
R5497:Adarb1 UTSW 10 77325889 missense probably damaging 0.96
R5869:Adarb1 UTSW 10 77325616 intron probably benign
R6168:Adarb1 UTSW 10 77322319 missense probably damaging 1.00
R7372:Adarb1 UTSW 10 77295878 critical splice acceptor site probably null
R7575:Adarb1 UTSW 10 77303295 missense probably damaging 0.99
R7885:Adarb1 UTSW 10 77295708 missense possibly damaging 0.50
R9227:Adarb1 UTSW 10 77321792 missense probably damaging 1.00
R9230:Adarb1 UTSW 10 77321792 missense probably damaging 1.00
R9457:Adarb1 UTSW 10 77322148 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CAGCAGCATGGAGTTTTGCC -3'
(R):5'- TAAGTTACTCTTTCTGGGCACCAC -3'

Sequencing Primer
(F):5'- CCTTTTTCTTTGTAGGGCCAGAGC -3'
(R):5'- ACAGGTTCCAGCAGCACTG -3'
Posted On 2022-04-18