Incidental Mutation 'R9359:Txndc2'
ID 708603
Institutional Source Beutler Lab
Gene Symbol Txndc2
Ensembl Gene ENSMUSG00000050612
Gene Name thioredoxin domain containing 2 (spermatozoa)
Synonyms Sptrx-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock # R9359 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 65637505-65642204 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 65637997 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 395 (T395I)
Ref Sequence ENSEMBL: ENSMUSP00000054909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050236]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000050236
AA Change: T395I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054909
Gene: ENSMUSG00000050612
AA Change: T395I

DomainStartEndE-ValueType
low complexity region 10 19 N/A INTRINSIC
internal_repeat_1 70 232 1.7e-7 PROSPERO
internal_repeat_1 252 426 1.7e-7 PROSPERO
Pfam:Thioredoxin 447 548 3.6e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene displays normal reproductive system phenotype while results in increased body size, increased serum phosphorus level and decreased serum IL-6 response to LPS challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Ankrd50 A T 3: 38,483,023 N60K probably damaging Het
Atp6v0a4 G A 6: 38,082,113 T245I probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Cyp2j13 T C 4: 96,061,933 D277G probably damaging Het
Def8 A T 8: 123,458,366 I310F probably benign Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Gabbr1 A G 17: 37,070,713 T790A probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm10549 C T 18: 33,464,322 P54S unknown Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Ifnar1 C T 16: 91,495,479 P207L probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Insr G C 8: 3,158,717 P1248R probably damaging Het
Ipcef1 C T 10: 6,890,663 D349N probably damaging Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mex3d A T 10: 80,381,747 N545K Het
Mios T A 6: 8,214,894 V30E probably benign Het
Muc16 A G 9: 18,537,764 probably null Het
Naxd A G 8: 11,512,968 K303E possibly damaging Het
Olfr1497 C T 19: 13,794,836 M258I probably damaging Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pknox1 C T 17: 31,603,255 T332M possibly damaging Het
Ptgdr A G 14: 44,853,258 S348P Het
Ptpdc1 T A 13: 48,586,554 E467V probably benign Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rfx4 A G 10: 84,905,057 T680A probably benign Het
Slc30a5 T C 13: 100,813,462 T371A probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tbxa2r A G 10: 81,333,124 S216G probably damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Uspl1 G A 5: 149,209,671 V411M probably damaging Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Vps54 A G 11: 21,292,108 T408A probably benign Het
Wscd1 T C 11: 71,759,973 L42P possibly damaging Het
Other mutations in Txndc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Txndc2 APN 17 65638574 missense probably benign 0.41
IGL00985:Txndc2 APN 17 65638549 missense possibly damaging 0.95
IGL01304:Txndc2 APN 17 65638453 missense possibly damaging 0.79
IGL01525:Txndc2 APN 17 65638913 missense possibly damaging 0.84
IGL02472:Txndc2 APN 17 65637976 missense possibly damaging 0.86
IGL02559:Txndc2 APN 17 65639590 missense possibly damaging 0.91
IGL02802:Txndc2 UTSW 17 65639606 missense possibly damaging 0.93
R0508:Txndc2 UTSW 17 65637953 missense probably benign 0.01
R0737:Txndc2 UTSW 17 65639553 critical splice donor site probably null
R1525:Txndc2 UTSW 17 65638315 missense probably damaging 1.00
R1569:Txndc2 UTSW 17 65638926 missense probably benign 0.44
R1746:Txndc2 UTSW 17 65638135 missense probably damaging 1.00
R4063:Txndc2 UTSW 17 65638084 missense possibly damaging 0.86
R4971:Txndc2 UTSW 17 65638854 missense probably damaging 0.96
R4983:Txndc2 UTSW 17 65638060 missense probably benign 0.01
R6177:Txndc2 UTSW 17 65638471 missense probably benign 0.44
R6762:Txndc2 UTSW 17 65638972 missense probably damaging 0.99
R6915:Txndc2 UTSW 17 65638291 missense probably benign
R7574:Txndc2 UTSW 17 65638625 missense possibly damaging 0.86
R7775:Txndc2 UTSW 17 65638243 missense probably benign 0.01
R9294:Txndc2 UTSW 17 65639024 missense unknown
R9403:Txndc2 UTSW 17 65637997 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGATCACTCTCACCAAGCC -3'
(R):5'- AAAGACAGCATTCAGTCCAAGG -3'

Sequencing Primer
(F):5'- AAGCCTTCCTCCAGGGTC -3'
(R):5'- TTCAGTCCAAGGAGACTAAAGTC -3'
Posted On 2022-04-18