Incidental Mutation 'R9359:Atp6v0a4'
ID 708574
Institutional Source Beutler Lab
Gene Symbol Atp6v0a4
Ensembl Gene ENSMUSG00000038600
Gene Name ATPase, H+ transporting, lysosomal V0 subunit A4
Synonyms V-ATPase alpha 4, Atp6n1b
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9359 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 38048483-38124586 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 38082113 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 245 (T245I)
Ref Sequence ENSEMBL: ENSMUSP00000039381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040259] [ENSMUST00000114908]
AlphaFold Q920R6
Predicted Effect probably benign
Transcript: ENSMUST00000040259
AA Change: T245I

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039381
Gene: ENSMUSG00000038600
AA Change: T245I

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 824 3.5e-293 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114908
AA Change: T245I

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110558
Gene: ENSMUSG00000038600
AA Change: T245I

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 823 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. This gene is one of four genes in man and mouse that encode different isoforms of the a subunit. Alternatively spliced transcript variants encoding the same protein have been described. Mutations in this gene are associated with renal tubular acidosis associated with preserved hearing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display postnatal or premature lethality, hyperchloremic hypokalemic acidosis with hypocitraturia, inner ear defects, impaired hearing, and impaired olfaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Ankrd50 A T 3: 38,483,023 N60K probably damaging Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Cyp2j13 T C 4: 96,061,933 D277G probably damaging Het
Def8 A T 8: 123,458,366 I310F probably benign Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Gabbr1 A G 17: 37,070,713 T790A probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm10549 C T 18: 33,464,322 P54S unknown Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Ifnar1 C T 16: 91,495,479 P207L probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Insr G C 8: 3,158,717 P1248R probably damaging Het
Ipcef1 C T 10: 6,890,663 D349N probably damaging Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mex3d A T 10: 80,381,747 N545K Het
Mios T A 6: 8,214,894 V30E probably benign Het
Muc16 A G 9: 18,537,764 probably null Het
Naxd A G 8: 11,512,968 K303E possibly damaging Het
Olfr1438-ps1 T A 19: 12,333,439 H139L possibly damaging Het
Olfr1497 C T 19: 13,794,836 M258I probably damaging Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pknox1 C T 17: 31,603,255 T332M possibly damaging Het
Ptgdr A G 14: 44,853,258 S348P Het
Ptpdc1 T A 13: 48,586,554 E467V probably benign Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rfx4 A G 10: 84,905,057 T680A probably benign Het
Slc30a5 T C 13: 100,813,462 T371A probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tbxa2r A G 10: 81,333,124 S216G probably damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Thoc6 A G 17: 23,668,849 V328A possibly damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Uspl1 G A 5: 149,209,671 V411M probably damaging Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Vps54 A G 11: 21,292,108 T408A probably benign Het
Wscd1 T C 11: 71,759,973 L42P possibly damaging Het
Other mutations in Atp6v0a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Atp6v0a4 APN 6 38092790 nonsense probably null
IGL01358:Atp6v0a4 APN 6 38074210 missense probably damaging 1.00
IGL01781:Atp6v0a4 APN 6 38074160 missense possibly damaging 0.91
IGL01934:Atp6v0a4 APN 6 38051546 missense possibly damaging 0.90
IGL01953:Atp6v0a4 APN 6 38054617 missense probably damaging 0.97
IGL03190:Atp6v0a4 APN 6 38054556 missense probably benign 0.02
R0049:Atp6v0a4 UTSW 6 38082081 missense probably damaging 1.00
R0049:Atp6v0a4 UTSW 6 38082081 missense probably damaging 1.00
R0100:Atp6v0a4 UTSW 6 38076815 missense probably benign
R0105:Atp6v0a4 UTSW 6 38053129 splice site probably benign
R1569:Atp6v0a4 UTSW 6 38050625 missense probably damaging 1.00
R1754:Atp6v0a4 UTSW 6 38067829 missense probably benign
R2142:Atp6v0a4 UTSW 6 38082936 nonsense probably null
R2162:Atp6v0a4 UTSW 6 38088646 missense possibly damaging 0.89
R2433:Atp6v0a4 UTSW 6 38082029 critical splice donor site probably null
R2892:Atp6v0a4 UTSW 6 38053017 missense probably benign 0.00
R4599:Atp6v0a4 UTSW 6 38078802 missense probably benign 0.01
R4687:Atp6v0a4 UTSW 6 38092465 missense possibly damaging 0.95
R4716:Atp6v0a4 UTSW 6 38061064 missense probably damaging 1.00
R4938:Atp6v0a4 UTSW 6 38078814 missense possibly damaging 0.80
R5062:Atp6v0a4 UTSW 6 38074183 missense probably benign 0.05
R5437:Atp6v0a4 UTSW 6 38076733 missense probably damaging 0.97
R5440:Atp6v0a4 UTSW 6 38092817 missense probably damaging 0.96
R5697:Atp6v0a4 UTSW 6 38050507 splice site probably null
R5698:Atp6v0a4 UTSW 6 38050507 splice site probably null
R6425:Atp6v0a4 UTSW 6 38050511 missense possibly damaging 0.88
R7659:Atp6v0a4 UTSW 6 38071972 missense probably damaging 1.00
R8004:Atp6v0a4 UTSW 6 38050549 missense possibly damaging 0.93
R8270:Atp6v0a4 UTSW 6 38074229 missense probably damaging 1.00
R8683:Atp6v0a4 UTSW 6 38048991 makesense probably null
R9007:Atp6v0a4 UTSW 6 38053053 missense probably benign
R9475:Atp6v0a4 UTSW 6 38060982 missense probably damaging 1.00
Z1176:Atp6v0a4 UTSW 6 38049036 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TAGCAAACATTCCAGGCAGG -3'
(R):5'- CCAGCTTTCTGTAGAACAATGTTG -3'

Sequencing Primer
(F):5'- CAGGGGCCTGGGGATTG -3'
(R):5'- AGGCTGGCCTGAAATTCACTC -3'
Posted On 2022-04-18