Incidental Mutation 'R6177:Txndc2'
ID487848
Institutional Source Beutler Lab
Gene Symbol Txndc2
Ensembl Gene ENSMUSG00000050612
Gene Namethioredoxin domain containing 2 (spermatozoa)
SynonymsSptrx-1
MMRRC Submission 044319-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R6177 (G1)
Quality Score118.008
Status Validated
Chromosome17
Chromosomal Location65637505-65642204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65638471 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 237 (D237G)
Ref Sequence ENSEMBL: ENSMUSP00000054909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050236]
Predicted Effect probably benign
Transcript: ENSMUST00000050236
AA Change: D237G

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000054909
Gene: ENSMUSG00000050612
AA Change: D237G

DomainStartEndE-ValueType
low complexity region 10 19 N/A INTRINSIC
internal_repeat_1 70 232 1.7e-7 PROSPERO
internal_repeat_1 252 426 1.7e-7 PROSPERO
Pfam:Thioredoxin 447 548 3.6e-24 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene displays normal reproductive system phenotype while results in increased body size, increased serum phosphorus level and decreased serum IL-6 response to LPS challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,750 I102T possibly damaging Het
Abcd2 T C 15: 91,190,693 I306V probably damaging Het
Actrt3 A T 3: 30,598,167 Y259* probably null Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ano1 T A 7: 144,678,741 M25L possibly damaging Het
Apol10b A T 15: 77,585,787 D63E possibly damaging Het
Atp6v1c1 C A 15: 38,673,928 S55* probably null Het
C1s2 T G 6: 124,630,001 D296A probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cadm4 G A 7: 24,502,761 V342M possibly damaging Het
Cat T C 2: 103,473,075 E119G probably damaging Het
Cavin2 G T 1: 51,289,495 S37I probably damaging Het
Cdk5rap2 G A 4: 70,281,482 R802C probably damaging Het
Clip1 A G 5: 123,613,834 probably benign Het
Dhx57 T C 17: 80,272,966 N519S possibly damaging Het
Dpep2 T C 8: 105,986,199 D260G probably damaging Het
Edem1 T A 6: 108,851,198 probably null Het
Epb41l4a A T 18: 33,798,815 probably null Het
Esp1 T C 17: 40,728,832 S3P possibly damaging Het
Fam111a A G 19: 12,587,382 Y165C probably damaging Het
Fstl4 A G 11: 53,168,204 T497A probably benign Het
Gm281 T C 14: 13,868,002 D229G probably benign Het
Gstcd T C 3: 133,082,073 D288G probably damaging Het
Hmcn2 T A 2: 31,420,106 L3264* probably null Het
Hyal4 T A 6: 24,766,090 L481* probably null Het
Ighv2-7 A G 12: 113,807,435 Y77H possibly damaging Het
Jdp2 G T 12: 85,638,840 R125L probably benign Het
Lrp1b A T 2: 41,123,736 probably null Het
Lrp2 AC A 2: 69,510,419 probably null Het
Marveld2 C T 13: 100,597,378 D250N probably damaging Het
Mast3 A G 8: 70,790,018 S53P probably damaging Het
Myo3b T C 2: 70,313,363 V1041A probably benign Het
Nkpd1 T A 7: 19,523,084 F113I probably damaging Het
Obscn A G 11: 59,032,664 S6470P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1015 C T 2: 85,785,660 R50C probably damaging Het
Olfr1246 T C 2: 89,590,317 D266G possibly damaging Het
Pdcd11 G T 19: 47,120,283 G1246V probably damaging Het
Phc3 A T 3: 30,942,565 S219T probably damaging Het
Plxnb1 C T 9: 109,102,925 probably null Het
Polh T C 17: 46,184,744 D276G possibly damaging Het
Polq T A 16: 37,071,709 V1991E probably damaging Het
Polr2g G A 19: 8,794,177 R144C probably damaging Het
Pramef25 G A 4: 143,949,006 H417Y possibly damaging Het
Prex2 A C 1: 11,136,777 T520P possibly damaging Het
Psg21 T A 7: 18,652,354 T236S possibly damaging Het
Ptpru A T 4: 131,793,525 S761R probably benign Het
Rapgef6 G A 11: 54,620,016 R253Q probably damaging Het
Rc3h2 C T 2: 37,389,646 V524I probably benign Het
Sde2 T C 1: 180,858,219 V112A probably damaging Het
Sept7 T C 9: 25,293,804 probably null Het
Spef2 A G 15: 9,727,532 V155A possibly damaging Het
St7 T C 6: 17,819,334 probably null Het
Tmcc3 A T 10: 94,582,387 Y339F probably damaging Het
Tmed6 T C 8: 107,065,451 E54G probably damaging Het
Tnks1bp1 C T 2: 85,059,280 probably benign Het
Trim43c T C 9: 88,840,547 L82P possibly damaging Het
Vmn1r91 T A 7: 20,101,479 C108S possibly damaging Het
Vtn A T 11: 78,500,010 D165V probably damaging Het
Wdr3 A T 3: 100,161,152 S13R probably damaging Het
Zdhhc16 A G 19: 41,937,759 Y31C probably benign Het
Zfp39 A T 11: 58,891,061 W292R probably benign Het
Zfp612 A T 8: 110,089,974 L604F probably damaging Het
Other mutations in Txndc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Txndc2 APN 17 65638574 missense probably benign 0.41
IGL00985:Txndc2 APN 17 65638549 missense possibly damaging 0.95
IGL01304:Txndc2 APN 17 65638453 missense possibly damaging 0.79
IGL01525:Txndc2 APN 17 65638913 missense possibly damaging 0.84
IGL02472:Txndc2 APN 17 65637976 missense possibly damaging 0.86
IGL02559:Txndc2 APN 17 65639590 missense possibly damaging 0.91
IGL02802:Txndc2 UTSW 17 65639606 missense possibly damaging 0.93
R0508:Txndc2 UTSW 17 65637953 missense probably benign 0.01
R0737:Txndc2 UTSW 17 65639553 critical splice donor site probably null
R1525:Txndc2 UTSW 17 65638315 missense probably damaging 1.00
R1569:Txndc2 UTSW 17 65638926 missense probably benign 0.44
R1746:Txndc2 UTSW 17 65638135 missense probably damaging 1.00
R4063:Txndc2 UTSW 17 65638084 missense possibly damaging 0.86
R4971:Txndc2 UTSW 17 65638854 missense probably damaging 0.96
R4983:Txndc2 UTSW 17 65638060 missense probably benign 0.01
R6762:Txndc2 UTSW 17 65638972 missense probably damaging 0.99
R6915:Txndc2 UTSW 17 65638291 missense probably benign
R7574:Txndc2 UTSW 17 65638625 missense possibly damaging 0.86
R7775:Txndc2 UTSW 17 65638243 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACGCTGTCTTCTGAGGACTTG -3'
(R):5'- TTACAGGGAGGATGACATTCCC -3'

Sequencing Primer
(F):5'- CTGAGGACTTGGGCCTGTC -3'
(R):5'- GGAGGATGACATTCCCAAGTCCTC -3'
Posted On2017-10-10