Incidental Mutation 'R9360:Hlcs'
ID 708659
Institutional Source Beutler Lab
Gene Symbol Hlcs
Ensembl Gene ENSMUSG00000040820
Gene Name holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
Synonyms D16Jhu34, 410I21.SP6
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9360 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 94128882-94313571 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 94131813 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 717 (I717N)
Ref Sequence ENSEMBL: ENSMUSP00000130981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072182] [ENSMUST00000099512] [ENSMUST00000163193] [ENSMUST00000227141] [ENSMUST00000227698] [ENSMUST00000228910] [ENSMUST00000231688]
AlphaFold Q920N2
Predicted Effect probably benign
Transcript: ENSMUST00000072182
SMART Domains Protein: ENSMUSP00000072043
Gene: ENSMUSG00000062713

DomainStartEndE-ValueType
HLH 6 58 6.99e-5 SMART
PAS 79 145 7.8e-13 SMART
PAS 220 286 1.31e-5 SMART
PAC 292 335 2.44e-5 SMART
Pfam:SIM_C 358 650 4.5e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099512
AA Change: I717N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097112
Gene: ENSMUSG00000040820
AA Change: I717N

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
Pfam:BPL_LplA_LipB 467 599 1.9e-21 PFAM
Pfam:BPL_C 665 714 3.7e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163193
AA Change: I717N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130981
Gene: ENSMUSG00000040820
AA Change: I717N

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
Pfam:BPL_LplA_LipB 467 599 3.6e-30 PFAM
Pfam:BPL_C 665 714 4.9e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227141
AA Change: I864N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227698
Predicted Effect probably damaging
Transcript: ENSMUST00000228910
AA Change: I322N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000231688
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the binding of biotin to carboxylases and histones. The protein plays an important role in gluconeogenesis, fatty acid synthesis and branched chain amino acid catabolism. Defects in this gene are the cause of holocarboxylase synthetase deficiency. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Adam4 A G 12: 81,421,487 L120P probably damaging Het
Asb6 A G 2: 30,824,322 S259P probably damaging Het
Atp6v0a2 C A 5: 124,629,194 S7R possibly damaging Het
Btbd16 C T 7: 130,815,786 R344C probably damaging Het
Cacna1h G A 17: 25,375,362 A2274V probably benign Het
Caml A C 13: 55,623,217 N43H probably damaging Het
Ccar2 A G 14: 70,141,996 S518P probably damaging Het
Cdkl3 A G 11: 52,033,522 I546V probably null Het
Chac1 C T 2: 119,352,373 T84I probably damaging Het
Col6a6 T C 9: 105,767,487 T1201A probably benign Het
Csf1 T C 3: 107,753,842 T120A possibly damaging Het
Ctsj T A 13: 61,003,820 I95F probably benign Het
Cyp4f17 C T 17: 32,524,906 R353C probably benign Het
Depdc1a A G 3: 159,526,531 M640V possibly damaging Het
Dgkq A G 5: 108,650,603 V633A probably damaging Het
Fdft1 A T 14: 63,177,740 Y14* probably null Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Gfm2 T A 13: 97,153,244 V179E probably damaging Het
Gm813 T C 16: 58,613,871 D161G probably benign Het
Gpr12 A G 5: 146,583,489 F208L probably benign Het
Greb1 A G 12: 16,740,036 S4P probably damaging Het
Hormad1 G A 3: 95,576,311 A145T probably benign Het
Kcmf1 A T 6: 72,861,843 C33* probably null Het
Kif13a A T 13: 46,808,996 S561T probably benign Het
Klhl20 G T 1: 161,093,699 P571Q probably benign Het
Kpna6 A T 4: 129,653,842 M304K probably benign Het
Krt75 T C 15: 101,568,294 K387E probably damaging Het
Lum A T 10: 97,568,890 K216* probably null Het
Meioc A G 11: 102,674,953 N409S probably benign Het
Mrpl20 T C 4: 155,803,945 probably null Het
Naa16 A T 14: 79,356,503 I374N probably benign Het
Nbea A G 3: 56,035,898 I652T possibly damaging Het
Nhsl1 G A 10: 18,319,150 G56R probably damaging Het
Obscn T C 11: 59,082,824 I1894V probably benign Het
Olfr1288 T C 2: 111,479,339 I185T probably benign Het
Olfr157 A G 4: 43,835,765 S242P probably benign Het
Olfr510 T A 7: 108,667,770 L118Q probably damaging Het
Olfr859 T A 9: 19,809,233 V305D possibly damaging Het
Olig2 A C 16: 91,226,886 T163P probably damaging Het
Parp4 G A 14: 56,641,318 probably null Het
Pcdhb2 T C 18: 37,296,498 I508T probably damaging Het
Pcdhga8 T C 18: 37,726,734 F281S probably damaging Het
Pom121l12 T A 11: 14,599,516 M74K possibly damaging Het
Prpf8 T C 11: 75,490,330 Y219H possibly damaging Het
Rhag T C 17: 40,831,657 V251A possibly damaging Het
Rrs1 A G 1: 9,546,620 *366W probably null Het
Sgpp2 A G 1: 78,390,506 D92G probably damaging Het
Slc44a3 C A 3: 121,532,259 probably benign Het
Smg8 T C 11: 87,078,130 M257V probably benign Het
Taar7e T A 10: 24,038,051 Y146* probably null Het
Tet2 G T 3: 133,487,142 N510K possibly damaging Het
Tgfbr3 T C 5: 107,109,684 I836M unknown Het
Thada A G 17: 84,191,982 V1929A probably benign Het
Tram1l1 A T 3: 124,322,250 D353V probably damaging Het
Trf T A 9: 103,217,535 probably null Het
Trim15 A T 17: 36,867,050 C18S probably damaging Het
Vmn1r62 T C 7: 5,675,953 I211T probably damaging Het
Zdhhc17 A G 10: 110,947,304 V501A probably benign Het
Zfp563 A G 17: 33,105,454 E341G probably benign Het
Other mutations in Hlcs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01078:Hlcs APN 16 94133160 missense probably damaging 0.99
IGL02026:Hlcs APN 16 94134705 missense probably damaging 0.99
IGL02341:Hlcs APN 16 94231110 missense probably damaging 0.99
IGL03075:Hlcs APN 16 94138847 missense probably damaging 1.00
PIT4515001:Hlcs UTSW 16 94267416 missense probably benign 0.45
R0372:Hlcs UTSW 16 94138907 missense possibly damaging 0.69
R0664:Hlcs UTSW 16 94231311 missense probably damaging 1.00
R0731:Hlcs UTSW 16 94131852 missense probably damaging 1.00
R1465:Hlcs UTSW 16 94268292 missense probably damaging 0.99
R1465:Hlcs UTSW 16 94268292 missense probably damaging 0.99
R1761:Hlcs UTSW 16 94268007 missense probably benign 0.05
R2013:Hlcs UTSW 16 94262740 missense probably benign 0.17
R2014:Hlcs UTSW 16 94262740 missense probably benign 0.17
R2015:Hlcs UTSW 16 94262740 missense probably benign 0.17
R2204:Hlcs UTSW 16 94231152 missense probably benign 0.30
R2371:Hlcs UTSW 16 94268067 missense probably damaging 0.98
R3816:Hlcs UTSW 16 94133088 missense probably benign 0.11
R3822:Hlcs UTSW 16 94267981 missense probably benign 0.04
R4422:Hlcs UTSW 16 94138960 missense possibly damaging 0.56
R4657:Hlcs UTSW 16 94262698 missense probably benign 0.00
R4783:Hlcs UTSW 16 94268539 missense possibly damaging 0.82
R5347:Hlcs UTSW 16 94267524 missense possibly damaging 0.93
R5808:Hlcs UTSW 16 94262632 missense probably benign 0.00
R5940:Hlcs UTSW 16 94134712 missense probably damaging 0.99
R6341:Hlcs UTSW 16 94231163 missense probably damaging 1.00
R6943:Hlcs UTSW 16 94141402 missense possibly damaging 0.75
R7053:Hlcs UTSW 16 94268015 missense possibly damaging 0.91
R7157:Hlcs UTSW 16 94268164 nonsense probably null
R7166:Hlcs UTSW 16 94262726 missense possibly damaging 0.92
R7313:Hlcs UTSW 16 94267503 missense probably damaging 1.00
R7427:Hlcs UTSW 16 94267899 missense probably benign 0.00
R7428:Hlcs UTSW 16 94267899 missense probably benign 0.00
R7547:Hlcs UTSW 16 94231172 nonsense probably null
R7548:Hlcs UTSW 16 94133017 nonsense probably null
R8172:Hlcs UTSW 16 94267626 missense probably damaging 1.00
R8241:Hlcs UTSW 16 94267818 missense probably damaging 1.00
R8500:Hlcs UTSW 16 94262758 missense possibly damaging 0.89
R8940:Hlcs UTSW 16 94231226 missense probably benign
R9274:Hlcs UTSW 16 94287926 missense possibly damaging 0.85
R9361:Hlcs UTSW 16 94138940 missense probably benign 0.10
R9564:Hlcs UTSW 16 94134721 missense probably benign 0.01
X0065:Hlcs UTSW 16 94133173 missense probably damaging 1.00
Z1176:Hlcs UTSW 16 94262659 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAACTGGCCTCTAACTCTG -3'
(R):5'- AGTCACCGAGCAAGATGTCC -3'

Sequencing Primer
(F):5'- ACAACTGGCCTCTAACTCTGCATTAG -3'
(R):5'- GAGCAAGATGTCCCAGCCTTC -3'
Posted On 2022-04-18