Incidental Mutation 'R9372:March1'
ID 709389
Institutional Source Beutler Lab
Gene Symbol March1
Ensembl Gene ENSMUSG00000036469
Gene Name membrane-associated ring finger (C3HC4) 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock # R9372 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 65617900-66471637 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 66468493 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 274 (T274N)
Ref Sequence ENSEMBL: ENSMUSP00000105884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026681] [ENSMUST00000039540] [ENSMUST00000072482] [ENSMUST00000098708] [ENSMUST00000110253] [ENSMUST00000110255] [ENSMUST00000110256] [ENSMUST00000110258] [ENSMUST00000110259] [ENSMUST00000178982]
AlphaFold Q6NZQ8
Predicted Effect probably benign
Transcript: ENSMUST00000026681
SMART Domains Protein: ENSMUSP00000026681
Gene: ENSMUSG00000025591

DomainStartEndE-ValueType
Pfam:DUF2962 10 162 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000039540
AA Change: T264N

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000044070
Gene: ENSMUSG00000036469
AA Change: T264N

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072482
AA Change: T274N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000072302
Gene: ENSMUSG00000036469
AA Change: T274N

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098708
AA Change: T274N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000096305
Gene: ENSMUSG00000036469
AA Change: T274N

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110253
AA Change: T268N

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105882
Gene: ENSMUSG00000036469
AA Change: T268N

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110255
AA Change: T274N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000105884
Gene: ENSMUSG00000036469
AA Change: T274N

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110256
AA Change: T529N

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105885
Gene: ENSMUSG00000036469
AA Change: T529N

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 111 125 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
RINGv 330 378 2.14e-22 SMART
transmembrane domain 406 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110258
AA Change: T278N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000105887
Gene: ENSMUSG00000036469
AA Change: T278N

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110259
AA Change: T274N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000105888
Gene: ENSMUSG00000036469
AA Change: T274N

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178982
AA Change: T278N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000136545
Gene: ENSMUSG00000036469
AA Change: T278N

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH1 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH1 downregulates the surface expression of major histocompatibility complex (MHC) class II molecules (see MIM 142880) and other glycoproteins by directing them to the late endosomal/lysosomal compartment (Bartee et al., 2004 [PubMed 14722266]; Thibodeau et al., 2008 [PubMed 18389477]; De Gassart et al., 2008 [PubMed 18305173]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal dendritic cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
7420426K07Rik A G 9: 98,903,425 I48V probably benign Het
Aass T C 6: 23,078,857 T719A probably damaging Het
Abcb8 A G 5: 24,400,116 E100G probably benign Het
Actr1b C T 1: 36,702,480 E104K probably damaging Het
Atad5 T A 11: 80,094,268 S60R possibly damaging Het
Bcan G T 3: 87,988,303 A842D probably benign Het
Cacna2d2 G A 9: 107,517,603 E623K probably benign Het
Cdk15 T C 1: 59,330,983 Y393H probably benign Het
Ceacam12 C T 7: 18,069,304 R212C probably benign Het
Ceacam5 T C 7: 17,747,342 I338T possibly damaging Het
Crcp A G 5: 130,059,823 D139G possibly damaging Het
Crls1 T A 2: 132,865,882 Y290* probably null Het
Dcun1d5 A G 9: 7,206,780 N206D probably damaging Het
Dmtf1 A T 5: 9,140,399 V105E possibly damaging Het
Dnah7a T C 1: 53,504,315 Y2232C probably benign Het
Dnajc25 T A 4: 59,003,394 V55E probably damaging Het
Dpy19l4 T C 4: 11,303,343 M193V possibly damaging Het
Dsc1 A T 18: 20,088,432 V662E probably damaging Het
Enpp6 G A 8: 47,053,592 V144I possibly damaging Het
Fip1l1 A G 5: 74,546,802 T204A possibly damaging Het
Flvcr2 T C 12: 85,747,021 V57A probably benign Het
Fsip2 T G 2: 82,992,412 I6163S possibly damaging Het
Gipr T A 7: 19,162,938 M136L probably benign Het
Gm7298 A G 6: 121,771,787 I674V probably benign Het
Gtf2a1 C T 12: 91,567,818 V221I probably damaging Het
Haus3 A T 5: 34,163,658 D481E probably benign Het
Hinfp A C 9: 44,297,786 V345G probably damaging Het
Hs3st5 A T 10: 36,832,702 K78* probably null Het
Ighv1-31 T C 12: 114,829,274 Y114C probably damaging Het
Ighv5-15 T A 12: 113,826,737 T88S probably damaging Het
Ildr1 G A 16: 36,722,359 D418N probably damaging Het
Ints10 C T 8: 68,819,315 T556I probably damaging Het
Isoc1 G T 18: 58,659,685 R65L possibly damaging Het
Itm2c C T 1: 85,905,334 R130C probably damaging Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Kif11 T C 19: 37,411,444 V793A probably benign Het
Klrg1 A C 6: 122,279,740 V29G probably benign Het
Lrch4 A G 5: 137,633,691 T114A possibly damaging Het
Map3k3 C T 11: 106,142,509 T196M probably damaging Het
Nxpe5 A T 5: 138,251,183 T412S probably benign Het
Olfr1494 C T 19: 13,749,705 H200Y probably benign Het
Pcnt A G 10: 76,423,126 W502R probably damaging Het
Pfdn5 T C 15: 102,326,851 probably null Het
Pkn2 A T 3: 142,829,257 V232E probably damaging Het
Ppfibp1 T C 6: 146,996,809 S88P probably damaging Het
Ptprz1 G A 6: 23,045,707 E2159K probably damaging Het
Smyd3 T C 1: 179,043,905 E303G possibly damaging Het
Snx13 T A 12: 35,101,049 N336K possibly damaging Het
Src A G 2: 157,469,888 E512G possibly damaging Het
Stard9 T A 2: 120,664,939 C98* probably null Het
Tapbpl A G 6: 125,226,709 V336A probably benign Het
Tbrg1 G A 9: 37,652,649 T230I probably damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem132c G A 5: 127,563,081 G772D probably damaging Het
Tmem219 C T 7: 126,896,845 G119S possibly damaging Het
Ttbk2 T A 2: 120,773,285 S325C probably benign Het
Ttc28 A T 5: 111,183,207 Y431F probably benign Het
Vmn1r27 A T 6: 58,215,761 M86K possibly damaging Het
Vmn2r15 G A 5: 109,294,087 P160L possibly damaging Het
Zfc3h1 A T 10: 115,385,318 S41C unknown Het
Zfp260 C A 7: 30,104,807 T44K probably benign Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Zfp760 A G 17: 21,722,054 N70S probably benign Het
Zfp788 T A 7: 41,650,284 Y781* probably null Het
Zfp800 A T 6: 28,256,434 S52T possibly damaging Het
Other mutations in March1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:March1 APN 8 66418877 missense possibly damaging 0.88
IGL02468:March1 APN 8 66418911 missense probably damaging 1.00
R0391:March1 UTSW 8 66418973 missense probably damaging 1.00
R1500:March1 UTSW 8 66468390 missense probably damaging 1.00
R1794:March1 UTSW 8 66386942 missense possibly damaging 0.63
R2015:March1 UTSW 8 66121821 missense probably damaging 0.99
R2184:March1 UTSW 8 66387423 missense probably benign 0.07
R2273:March1 UTSW 8 66387499 missense probably benign 0.15
R2274:March1 UTSW 8 66387499 missense probably benign 0.15
R2275:March1 UTSW 8 66387499 missense probably benign 0.15
R2314:March1 UTSW 8 66121790 start codon destroyed probably null 0.77
R3114:March1 UTSW 8 66387381 missense probably benign
R4458:March1 UTSW 8 66456171 missense probably damaging 1.00
R4656:March1 UTSW 8 66386419 missense probably benign 0.05
R4773:March1 UTSW 8 66387224 missense probably benign 0.03
R4838:March1 UTSW 8 66468363 missense probably damaging 1.00
R5073:March1 UTSW 8 66386368 missense probably benign 0.03
R5507:March1 UTSW 8 66418890 missense probably damaging 1.00
R5575:March1 UTSW 8 66468310 missense probably damaging 1.00
R5916:March1 UTSW 8 66387111 missense possibly damaging 0.89
R6931:March1 UTSW 8 66468492 missense probably benign 0.03
R7350:March1 UTSW 8 66468399 nonsense probably null
R7487:March1 UTSW 8 66456074 missense probably benign 0.14
R7531:March1 UTSW 8 66386337 missense probably benign
R7563:March1 UTSW 8 66468313 missense probably damaging 1.00
R7705:March1 UTSW 8 66468517 missense probably benign 0.00
R8142:March1 UTSW 8 66456126 missense probably benign 0.07
R8337:March1 UTSW 8 66418989 missense probably damaging 1.00
R8712:March1 UTSW 8 66468348 missense probably damaging 1.00
R9188:March1 UTSW 8 66456151 nonsense probably null
R9477:March1 UTSW 8 66418890 missense probably damaging 1.00
R9790:March1 UTSW 8 66276687 missense probably benign 0.17
R9791:March1 UTSW 8 66276687 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AAAGTCTACGTCCAACTGTGGC -3'
(R):5'- GACGGCTCTGCTTCTTGAGATC -3'

Sequencing Primer
(F):5'- TCCAACTGTGGCGCCGG -3'
(R):5'- CTGCTTCTTGAGATCCTGGTCATG -3'
Posted On 2022-04-18