Incidental Mutation 'R9379:Camsap1'
ID 709841
Institutional Source Beutler Lab
Gene Symbol Camsap1
Ensembl Gene ENSMUSG00000026933
Gene Name calmodulin regulated spectrin-associated protein 1
Synonyms 9530003A05Rik, PRO2405
Accession Numbers

Genbank: NM_001115076; MGI: 3036242

Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R9379 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 25926838-25983282 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25956306 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 132 (I132V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091268] [ENSMUST00000114167] [ENSMUST00000134882] [ENSMUST00000139937] [ENSMUST00000183461]
AlphaFold A2AHC3
Predicted Effect possibly damaging
Transcript: ENSMUST00000091268
AA Change: I202V

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000088812
Gene: ENSMUSG00000026933
AA Change: I202V

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 228 311 3.3e-35 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
Pfam:CAMSAP_CC1 859 917 3.8e-29 PFAM
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114167
AA Change: I202V

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109804
Gene: ENSMUSG00000026933
AA Change: I202V

DomainStartEndE-ValueType
Pfam:CH 185 330 5.4e-34 PFAM
Pfam:CAMSAP_CH 228 311 2.3e-34 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
coiled coil region 869 905 N/A INTRINSIC
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121689
Gene: ENSMUSG00000026933
AA Change: I132V

DomainStartEndE-ValueType
Blast:Beach 40 100 5e-6 BLAST
Pfam:CAMSAP_CH 170 253 1.4e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000134882
AA Change: I202V

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117203
Gene: ENSMUSG00000026933
AA Change: I202V

DomainStartEndE-ValueType
Pfam:CH 185 350 1.3e-33 PFAM
Pfam:CAMSAP_CH 248 331 2.6e-34 PFAM
low complexity region 752 767 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
coiled coil region 889 925 N/A INTRINSIC
coiled coil region 1030 1057 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139937
Predicted Effect probably benign
Transcript: ENSMUST00000142028
SMART Domains Protein: ENSMUSP00000119296
Gene: ENSMUSG00000026933

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 101 164 7.5e-28 PFAM
Predicted Effect
Predicted Effect
SMART Domains Protein: ENSMUSP00000123541
Gene: ENSMUSG00000026933
AA Change: I37V

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 88 171 5.7e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183461
AA Change: I202V

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139028
Gene: ENSMUSG00000026933
AA Change: I202V

DomainStartEndE-ValueType
Pfam:CH 185 330 5.4e-34 PFAM
Pfam:CAMSAP_CH 228 311 2.3e-34 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
coiled coil region 869 905 N/A INTRINSIC
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,451,201 I136F possibly damaging Het
1700019D03Rik T A 1: 52,925,476 D31V probably benign Het
Abca14 G T 7: 120,207,979 E83* probably null Het
Abcc5 T C 16: 20,333,687 T1370A probably damaging Het
Ankhd1 T C 18: 36,644,627 V1621A probably benign Het
Ano8 T A 8: 71,483,534 Q206L probably benign Het
Aox3 A T 1: 58,169,800 I831F possibly damaging Het
Armc4 T C 18: 7,265,089 D426G possibly damaging Het
Atp2a2 T C 5: 122,473,252 I168V probably benign Het
Atxn2 G A 5: 121,747,446 V239I probably damaging Het
B230219D22Rik C A 13: 55,699,470 A132E probably damaging Het
Btbd17 C A 11: 114,791,923 W321L possibly damaging Het
Cacna1i T A 15: 80,375,294 V1255E probably damaging Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Chd7 A G 4: 8,752,210 S236G unknown Het
Clasp1 CCTGCTGCTGCTGCTG CCTGCTGCTGCTGCTGCTG 1: 118,581,427 probably benign Het
Clasp1 TGC TGCCGC 1: 118,581,438 probably benign Het
Col4a1 T A 8: 11,199,838 H1658L unknown Het
D430042O09Rik T C 7: 125,870,676 L1439P probably damaging Het
D630044L22Rik A G 17: 25,961,882 H102R possibly damaging Het
Dact3 G A 7: 16,886,088 V503I unknown Het
Dcn G T 10: 97,507,781 R201L probably damaging Het
Dmxl1 T C 18: 49,891,500 V1747A possibly damaging Het
Dnajc14 T A 10: 128,816,874 probably null Het
Dspp A T 5: 104,174,894 probably null Het
Ep300 T C 15: 81,648,559 V1666A unknown Het
Flvcr2 A G 12: 85,803,226 I429V probably benign Het
Gpr158 A G 2: 21,368,231 probably benign Het
Grip1 G T 10: 119,945,056 L203F probably damaging Het
Hoga1 T C 19: 42,063,258 L250P probably damaging Het
Htr2b A G 1: 86,100,122 S221P probably damaging Het
Ighv1-24 T C 12: 114,773,043 Y79C possibly damaging Het
Kcnq1 A G 7: 143,191,432 T311A probably damaging Het
Kif21a C T 15: 90,969,827 R779Q probably damaging Het
Lilra6 T C 7: 3,913,167 E231G probably damaging Het
Lrrc8c T A 5: 105,608,490 Y710* probably null Het
Mixl1 A G 1: 180,694,693 S208P probably benign Het
Muc16 T A 9: 18,646,171 Q2942L unknown Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nlrp4e C G 7: 23,321,330 A414G probably benign Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nup85 T C 11: 115,578,598 I322T probably benign Het
Olfr826 A G 10: 130,180,736 M48T possibly damaging Het
Olfr860 T A 9: 19,845,916 K234N possibly damaging Het
Olfr878 C T 9: 37,919,151 L165F probably damaging Het
Olfr964-ps1 A G 9: 39,686,818 L42P probably damaging Het
Osbpl9 A T 4: 109,083,202 H178Q probably damaging Het
Parp14 A G 16: 35,860,483 V260A probably benign Het
Plxna2 C T 1: 194,810,166 T1777I probably damaging Het
Ppp3cb T C 14: 20,531,806 D47G probably benign Het
Pram1 T C 17: 33,641,467 V336A probably damaging Het
Prl T A 13: 27,059,520 I58N probably damaging Het
Qrich2 T C 11: 116,458,108 D630G unknown Het
Ralgapa1 G C 12: 55,722,798 P803A probably damaging Het
Rtcb A T 10: 85,943,207 probably null Het
Ryr2 C T 13: 11,883,116 C131Y probably damaging Het
Spata7 A G 12: 98,634,289 I54V probably benign Het
St6galnac3 A G 3: 153,509,433 V28A probably benign Het
Stra6l A T 4: 45,849,093 T6S probably benign Het
Taf4b C T 18: 14,813,374 T418M probably damaging Het
Taf6 A G 5: 138,183,690 I92T possibly damaging Het
Tcaf2 C T 6: 42,642,583 S170N probably benign Het
Tfrc A G 16: 32,625,001 D541G probably damaging Het
Trav13n-3 T G 14: 53,337,396 L32V probably damaging Het
Trpa1 T C 1: 14,896,515 T542A possibly damaging Het
Ttc39b A T 4: 83,271,139 S53T probably benign Het
Ubap2 A T 4: 41,216,630 S268T possibly damaging Het
Usp40 A G 1: 87,954,167 V998A probably benign Het
Usp44 T A 10: 93,852,773 I562K possibly damaging Het
Vmn2r106 T C 17: 20,275,804 T553A probably damaging Het
Vmn2r65 A G 7: 84,947,442 V135A probably damaging Het
Wbp2nl T A 15: 82,314,110 S283T possibly damaging Het
Wnk1 G A 6: 119,951,717 T1092I probably damaging Het
Zcchc6 T C 13: 59,788,474 Y1271C possibly damaging Het
Other mutations in Camsap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Camsap1 APN 2 25933623 missense possibly damaging 0.95
IGL01555:Camsap1 APN 2 25939393 missense possibly damaging 0.81
IGL01667:Camsap1 APN 2 25945281 splice site probably benign
IGL02167:Camsap1 APN 2 25934300 missense probably damaging 1.00
IGL02191:Camsap1 APN 2 25929880 missense probably damaging 0.97
IGL02285:Camsap1 APN 2 25929802 missense probably damaging 1.00
IGL02393:Camsap1 APN 2 25938322 missense probably benign 0.10
3-1:Camsap1 UTSW 2 25945178 missense probably damaging 1.00
R0631:Camsap1 UTSW 2 25933647 missense probably damaging 0.98
R0828:Camsap1 UTSW 2 25939085 missense probably damaging 1.00
R1434:Camsap1 UTSW 2 25945178 missense probably damaging 1.00
R1687:Camsap1 UTSW 2 25939615 missense probably damaging 1.00
R2027:Camsap1 UTSW 2 25938526 missense possibly damaging 0.51
R2048:Camsap1 UTSW 2 25929743 missense probably benign 0.00
R3732:Camsap1 UTSW 2 25938344 missense probably damaging 1.00
R4437:Camsap1 UTSW 2 25938646 missense possibly damaging 0.89
R4494:Camsap1 UTSW 2 25952758 missense probably damaging 1.00
R4888:Camsap1 UTSW 2 25935550 missense probably benign 0.03
R5028:Camsap1 UTSW 2 25944556 missense probably damaging 1.00
R5058:Camsap1 UTSW 2 25939363 missense probably benign 0.01
R5105:Camsap1 UTSW 2 25940929 missense probably damaging 1.00
R5121:Camsap1 UTSW 2 25935550 missense probably benign 0.03
R5153:Camsap1 UTSW 2 25933618 missense probably damaging 1.00
R5323:Camsap1 UTSW 2 25965811 missense probably damaging 0.98
R6043:Camsap1 UTSW 2 25929925 missense probably benign 0.00
R6479:Camsap1 UTSW 2 25935862 missense possibly damaging 0.88
R6502:Camsap1 UTSW 2 25956308 missense probably damaging 1.00
R6571:Camsap1 UTSW 2 25939500 missense possibly damaging 0.89
R7046:Camsap1 UTSW 2 25945189 missense probably damaging 0.99
R7251:Camsap1 UTSW 2 25938886 missense probably damaging 0.99
R8026:Camsap1 UTSW 2 25938202 missense probably benign 0.17
R8133:Camsap1 UTSW 2 25934297 missense probably damaging 0.99
R8152:Camsap1 UTSW 2 25940241 missense probably damaging 1.00
R8158:Camsap1 UTSW 2 25944428 nonsense probably null
R8325:Camsap1 UTSW 2 25939363 missense probably benign 0.01
R8339:Camsap1 UTSW 2 25982805 missense possibly damaging 0.74
R9187:Camsap1 UTSW 2 25930016 missense probably damaging 1.00
R9419:Camsap1 UTSW 2 25955292 missense
Z1176:Camsap1 UTSW 2 25936639 missense probably damaging 1.00
Z1176:Camsap1 UTSW 2 25940881 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATCTAAGAGGCCGGCTTGC -3'
(R):5'- ACATGGGAGAGCAGTAGCCTTC -3'

Sequencing Primer
(F):5'- CCGGCTTGCTCAGAGTG -3'
(R):5'- TGGTTGAGCAGTAGCCTT -3'
Posted On 2022-04-18