Incidental Mutation 'R9379:Taf4b'
ID 709902
Institutional Source Beutler Lab
Gene Symbol Taf4b
Ensembl Gene ENSMUSG00000054321
Gene Name TATA-box binding protein associated factor 4b
Synonyms Taf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock # R9379 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 14783245-14900359 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 14813374 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 418 (T418M)
Ref Sequence ENSEMBL: ENSMUSP00000126909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169862]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000169862
AA Change: T418M

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: T418M

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
Pfam:TAFH 257 348 5.3e-39 PFAM
low complexity region 359 376 N/A INTRINSIC
low complexity region 412 422 N/A INTRINSIC
Pfam:TAF4 610 852 4e-72 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,451,201 I136F possibly damaging Het
1700019D03Rik T A 1: 52,925,476 D31V probably benign Het
Abca14 G T 7: 120,207,979 E83* probably null Het
Abcc5 T C 16: 20,333,687 T1370A probably damaging Het
Ankhd1 T C 18: 36,644,627 V1621A probably benign Het
Ano8 T A 8: 71,483,534 Q206L probably benign Het
Aox3 A T 1: 58,169,800 I831F possibly damaging Het
Armc4 T C 18: 7,265,089 D426G possibly damaging Het
Atp2a2 T C 5: 122,473,252 I168V probably benign Het
Atxn2 G A 5: 121,747,446 V239I probably damaging Het
B230219D22Rik C A 13: 55,699,470 A132E probably damaging Het
Btbd17 C A 11: 114,791,923 W321L possibly damaging Het
Cacna1i T A 15: 80,375,294 V1255E probably damaging Het
Camsap1 T C 2: 25,956,306 I132V Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Chd7 A G 4: 8,752,210 S236G unknown Het
Clasp1 CCTGCTGCTGCTGCTG CCTGCTGCTGCTGCTGCTG 1: 118,581,427 probably benign Het
Clasp1 TGC TGCCGC 1: 118,581,438 probably benign Het
Col4a1 T A 8: 11,199,838 H1658L unknown Het
D430042O09Rik T C 7: 125,870,676 L1439P probably damaging Het
D630044L22Rik A G 17: 25,961,882 H102R possibly damaging Het
Dact3 G A 7: 16,886,088 V503I unknown Het
Dcn G T 10: 97,507,781 R201L probably damaging Het
Dmxl1 T C 18: 49,891,500 V1747A possibly damaging Het
Dnajc14 T A 10: 128,816,874 probably null Het
Dspp A T 5: 104,174,894 probably null Het
Ep300 T C 15: 81,648,559 V1666A unknown Het
Flvcr2 A G 12: 85,803,226 I429V probably benign Het
Gpr158 A G 2: 21,368,231 probably benign Het
Grip1 G T 10: 119,945,056 L203F probably damaging Het
Hoga1 T C 19: 42,063,258 L250P probably damaging Het
Htr2b A G 1: 86,100,122 S221P probably damaging Het
Ighv1-24 T C 12: 114,773,043 Y79C possibly damaging Het
Kcnq1 A G 7: 143,191,432 T311A probably damaging Het
Kif21a C T 15: 90,969,827 R779Q probably damaging Het
Lilra6 T C 7: 3,913,167 E231G probably damaging Het
Lrrc8c T A 5: 105,608,490 Y710* probably null Het
Mixl1 A G 1: 180,694,693 S208P probably benign Het
Muc16 T A 9: 18,646,171 Q2942L unknown Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nlrp4e C G 7: 23,321,330 A414G probably benign Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nup85 T C 11: 115,578,598 I322T probably benign Het
Olfr826 A G 10: 130,180,736 M48T possibly damaging Het
Olfr860 T A 9: 19,845,916 K234N possibly damaging Het
Olfr878 C T 9: 37,919,151 L165F probably damaging Het
Olfr964-ps1 A G 9: 39,686,818 L42P probably damaging Het
Osbpl9 A T 4: 109,083,202 H178Q probably damaging Het
Parp14 A G 16: 35,860,483 V260A probably benign Het
Plxna2 C T 1: 194,810,166 T1777I probably damaging Het
Ppp3cb T C 14: 20,531,806 D47G probably benign Het
Pram1 T C 17: 33,641,467 V336A probably damaging Het
Prl T A 13: 27,059,520 I58N probably damaging Het
Qrich2 T C 11: 116,458,108 D630G unknown Het
Ralgapa1 G C 12: 55,722,798 P803A probably damaging Het
Rtcb A T 10: 85,943,207 probably null Het
Ryr2 C T 13: 11,883,116 C131Y probably damaging Het
Spata7 A G 12: 98,634,289 I54V probably benign Het
St6galnac3 A G 3: 153,509,433 V28A probably benign Het
Stra6l A T 4: 45,849,093 T6S probably benign Het
Taf6 A G 5: 138,183,690 I92T possibly damaging Het
Tcaf2 C T 6: 42,642,583 S170N probably benign Het
Tfrc A G 16: 32,625,001 D541G probably damaging Het
Trav13n-3 T G 14: 53,337,396 L32V probably damaging Het
Trpa1 T C 1: 14,896,515 T542A possibly damaging Het
Ttc39b A T 4: 83,271,139 S53T probably benign Het
Ubap2 A T 4: 41,216,630 S268T possibly damaging Het
Usp40 A G 1: 87,954,167 V998A probably benign Het
Usp44 T A 10: 93,852,773 I562K possibly damaging Het
Vmn2r106 T C 17: 20,275,804 T553A probably damaging Het
Vmn2r65 A G 7: 84,947,442 V135A probably damaging Het
Wbp2nl T A 15: 82,314,110 S283T possibly damaging Het
Wnk1 G A 6: 119,951,717 T1092I probably damaging Het
Zcchc6 T C 13: 59,788,474 Y1271C possibly damaging Het
Other mutations in Taf4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Taf4b APN 18 14844420 missense probably damaging 1.00
IGL01755:Taf4b APN 18 14897985 missense probably benign
IGL01755:Taf4b APN 18 14897986 missense probably benign 0.13
IGL02049:Taf4b APN 18 14830139 missense probably benign 0.00
IGL02650:Taf4b APN 18 14841983 nonsense probably null
IGL03078:Taf4b APN 18 14813554 missense possibly damaging 0.48
IGL03169:Taf4b APN 18 14821535 missense probably damaging 1.00
IGL03261:Taf4b APN 18 14821528 missense probably benign
adirondack UTSW 18 14804578 missense probably null 0.16
R0266:Taf4b UTSW 18 14813077 splice site probably benign
R0385:Taf4b UTSW 18 14783760 missense probably benign 0.00
R1015:Taf4b UTSW 18 14813098 missense probably damaging 1.00
R1054:Taf4b UTSW 18 14821473 missense probably benign 0.00
R1416:Taf4b UTSW 18 14821427 splice site probably benign
R1435:Taf4b UTSW 18 14807409 missense probably damaging 1.00
R1609:Taf4b UTSW 18 14835881 missense probably damaging 1.00
R1611:Taf4b UTSW 18 14844469 missense probably null 1.00
R1906:Taf4b UTSW 18 14822102 missense probably benign 0.00
R2038:Taf4b UTSW 18 14807399 missense probably damaging 1.00
R2890:Taf4b UTSW 18 14804792 missense probably damaging 1.00
R4527:Taf4b UTSW 18 14821442 missense probably damaging 1.00
R4559:Taf4b UTSW 18 14813526 missense probably damaging 1.00
R4773:Taf4b UTSW 18 14804520 missense probably benign 0.30
R4857:Taf4b UTSW 18 14804578 missense probably null 0.16
R4946:Taf4b UTSW 18 14813542 missense probably damaging 1.00
R4984:Taf4b UTSW 18 14835816 missense probably damaging 1.00
R4994:Taf4b UTSW 18 14898043 missense probably damaging 0.99
R5010:Taf4b UTSW 18 14822172 missense possibly damaging 0.59
R5155:Taf4b UTSW 18 14830095 missense probably benign 0.07
R5874:Taf4b UTSW 18 14804554 missense probably benign
R6079:Taf4b UTSW 18 14822198 missense possibly damaging 0.75
R6303:Taf4b UTSW 18 14807355 missense probably damaging 1.00
R6304:Taf4b UTSW 18 14807355 missense probably damaging 1.00
R6372:Taf4b UTSW 18 14804733 missense probably damaging 1.00
R6972:Taf4b UTSW 18 14813347 missense possibly damaging 0.86
R7538:Taf4b UTSW 18 14813545 missense probably damaging 1.00
R7790:Taf4b UTSW 18 14813274 missense probably damaging 1.00
R8021:Taf4b UTSW 18 14804524 missense probably damaging 1.00
R8072:Taf4b UTSW 18 14821528 missense probably benign
R8075:Taf4b UTSW 18 14783692 missense possibly damaging 0.58
R8145:Taf4b UTSW 18 14830028 missense probably damaging 1.00
R8221:Taf4b UTSW 18 14898049 missense probably damaging 1.00
R8320:Taf4b UTSW 18 14783692 missense possibly damaging 0.58
R8509:Taf4b UTSW 18 14898055 missense probably damaging 1.00
R8535:Taf4b UTSW 18 14822138 missense probably damaging 0.99
R8772:Taf4b UTSW 18 14835852 missense probably damaging 1.00
R8805:Taf4b UTSW 18 14813428 missense possibly damaging 0.65
R8874:Taf4b UTSW 18 14830070 missense probably benign 0.39
R9155:Taf4b UTSW 18 14813239 missense probably benign 0.00
R9254:Taf4b UTSW 18 14813374 missense probably damaging 0.98
R9338:Taf4b UTSW 18 14821498 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACAGCAACGTCTCCTGTGG -3'
(R):5'- GCAGGTTTATCAGCTTTGGTCC -3'

Sequencing Primer
(F):5'- TGGTGACAAGTACAGTTTCCCCAG -3'
(R):5'- TATCAGCTTTGGTCCCAGCAGAG -3'
Posted On 2022-04-18