Mutagenetix > Incidental Mutation

Incidental Mutation 'R9383:Odf2'

710131

Institutional Source

Beutler Lab

Gene Symbol

Odf2

Ensembl Gene

ENSMUSG00000026790

Gene Name

outer dense fiber of sperm tails 2

Synonyms

MMTEST29, cenexin

MMRRC Submission

Accession Numbers

Genbank: NM_001113213; MGI: 1098824

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9383 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

29889221-29931746 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 29901237 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 181 (L181H)

Ref Sequence

ENSEMBL: ENSMUSP00000109396 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028128] [ENSMUST00000046571] [ENSMUST00000113755] [ENSMUST00000113756] [ENSMUST00000113757] [ENSMUST00000113759] [ENSMUST00000113762] [ENSMUST00000113763] [ENSMUST00000113764] [ENSMUST00000113765] [ENSMUST00000113767] [ENSMUST00000123335] [ENSMUST00000133233] [ENSMUST00000184845]

AlphaFold

A3KGV1

Predicted Effect

probably damaging
Transcript: ENSMUST00000028128
AA Change: L118H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028128
Gene: ENSMUSG00000026790
AA Change: L118H

Domain	Start	End	E-Value	Type
coiled coil region	125	197	N/A	INTRINSIC
internal_repeat_1	248	284	1.04e-5	PROSPERO
internal_repeat_1	447	481	1.04e-5	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000046571
AA Change: L132H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000049272
Gene: ENSMUSG00000026790
AA Change: L132H

Domain	Start	End	E-Value	Type
internal_repeat_2	120	138	1.77e-5	PROSPERO
coiled coil region	139	211	N/A	INTRINSIC
internal_repeat_2	218	236	1.77e-5	PROSPERO
internal_repeat_1	262	298	8.12e-7	PROSPERO
internal_repeat_1	461	495	8.12e-7	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000113755
AA Change: L132H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109384
Gene: ENSMUSG00000026790
AA Change: L132H

Domain	Start	End	E-Value	Type
coiled coil region	139	211	N/A	INTRINSIC
internal_repeat_1	262	298	2.12e-5	PROSPERO
internal_repeat_1	461	495	2.12e-5	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000113756
AA Change: L132H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109385
Gene: ENSMUSG00000026790
AA Change: L132H

Domain	Start	End	E-Value	Type
internal_repeat_2	120	138	1.77e-5	PROSPERO
coiled coil region	139	211	N/A	INTRINSIC
internal_repeat_2	218	236	1.77e-5	PROSPERO
internal_repeat_1	262	298	8.12e-7	PROSPERO
internal_repeat_1	461	495	8.12e-7	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000113757
AA Change: L113H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109386
Gene: ENSMUSG00000026790
AA Change: L113H

Domain	Start	End	E-Value	Type
internal_repeat_2	101	119	9.13e-6	PROSPERO
coiled coil region	120	192	N/A	INTRINSIC
internal_repeat_2	199	217	9.13e-6	PROSPERO
internal_repeat_1	243	279	3.83e-7	PROSPERO
internal_repeat_1	442	476	3.83e-7	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000113759
AA Change: L132H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109388
Gene: ENSMUSG00000026790
AA Change: L132H

Domain	Start	End	E-Value	Type
internal_repeat_2	120	138	1.82e-5	PROSPERO
coiled coil region	139	211	N/A	INTRINSIC
internal_repeat_2	218	236	1.82e-5	PROSPERO
internal_repeat_1	262	299	1.55e-6	PROSPERO
internal_repeat_1	462	496	1.55e-6	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000113762
AA Change: L137H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109391
Gene: ENSMUSG00000026790
AA Change: L137H

Domain	Start	End	E-Value	Type
coiled coil region	144	216	N/A	INTRINSIC
internal_repeat_1	267	303	1.9e-5	PROSPERO
internal_repeat_1	466	500	1.9e-5	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000113763
AA Change: L118H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109392
Gene: ENSMUSG00000026790
AA Change: L118H

Domain	Start	End	E-Value	Type
coiled coil region	125	197	N/A	INTRINSIC
internal_repeat_1	248	284	1.04e-5	PROSPERO
internal_repeat_1	447	481	1.04e-5	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000113764
AA Change: L118H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109393
Gene: ENSMUSG00000026790
AA Change: L118H

Domain	Start	End	E-Value	Type
coiled coil region	125	197	N/A	INTRINSIC
internal_repeat_1	248	284	1.04e-5	PROSPERO
internal_repeat_1	447	481	1.04e-5	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000113765
AA Change: L137H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109394
Gene: ENSMUSG00000026790
AA Change: L137H

Domain	Start	End	E-Value	Type
internal_repeat_2	125	143	1.66e-5	PROSPERO
coiled coil region	144	216	N/A	INTRINSIC
internal_repeat_2	223	241	1.66e-5	PROSPERO
internal_repeat_1	267	303	7.56e-7	PROSPERO
internal_repeat_1	466	500	7.56e-7	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000113767
AA Change: L181H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109396
Gene: ENSMUSG00000026790
AA Change: L181H

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
coiled coil region	188	260	N/A	INTRINSIC
internal_repeat_1	311	347	3e-5	PROSPERO
internal_repeat_1	510	544	3e-5	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000123335

Predicted Effect

probably damaging
Transcript: ENSMUST00000133233
AA Change: L113H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

SMART Domains

Protein: ENSMUSP00000117887
Gene: ENSMUSG00000026790
AA Change: L136H

Domain	Start	End	E-Value	Type
coiled coil region	143	215	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000184845
AA Change: L132H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139390
Gene: ENSMUSG00000026790
AA Change: L132H

Domain	Start	End	E-Value	Type
coiled coil region	139	211	N/A	INTRINSIC
internal_repeat_1	262	298	3.95e-5	PROSPERO
internal_repeat_1	461	495	3.95e-5	PROSPERO

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The outer dense fibers are cytoskeletal structures that surround the axoneme in the middle piece and principal piece of the sperm tail. The fibers function in maintaining the elastic structure and recoil of the sperm tail as well as in protecting the tail from shear forces during epididymal transport and ejaculation. Defects in the outer dense fibers lead to abnormal sperm morphology and infertility. This gene encodes one of the major outer dense fiber proteins. Alternative splicing results in multiple transcript variants. The longer transcripts, also known as 'Cenexins', encode proteins with a C-terminal extension that are differentially targeted to somatic centrioles and thought to be crucial for the formation of microtubule organizing centers. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality before implantation and transmission ratio distortion while all heterozygous males display normal development and fertility. Males heterozygous for other alleles are either infertile orshow reduced fertility. [provided by MGI curators]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg5	A	G	8: 94,934,534	E124G		Het
Atp1a2	T	C	1: 172,279,767	I729V	probably benign	Het
Chd2	T	A	7: 73,449,170	E1467V	probably null	Het
Col6a5	T	C	9: 105,925,911	D1285G	unknown	Het
Coro7	A	G	16: 4,635,024	C287R	probably damaging	Het
Cpa3	T	C	3: 20,228,881	E134G	probably benign	Het
Csf3r	C	T	4: 126,043,446	P708S	possibly damaging	Het
Ctgf	T	G	10: 24,595,985	V58G	possibly damaging	Het
Defb30	T	C	14: 63,036,014	E49G	probably benign	Het
Dnah3	A	T	7: 120,047,596	I1070K	probably benign	Het
Dnm2	G	A	9: 21,472,624	V234M	probably damaging	Het
Drg2	T	A	11: 60,459,461	M82K	probably benign	Het
Dus2	G	A	8: 106,050,318	E312K	probably benign	Het
Efcab6	T	C	15: 83,872,419	E1240G	possibly damaging	Het
Ep400	T	C	5: 110,685,485	E1957G	unknown	Het
Gpnmb	A	G	6: 49,051,984	S479G	probably damaging	Het
Gpr153	T	C	4: 152,283,059	S456P	probably benign	Het
Gprc5b	A	T	7: 118,976,538	M388K	probably damaging	Het
H2-T23	T	C	17: 36,032,335	D50G	possibly damaging	Het
Hipk1	T	C	3: 103,777,567	E244G	probably damaging	Het
Malrd1	T	A	2: 15,695,201	C620S	unknown	Het
Maz	G	A	7: 127,024,911	Q358*	probably null	Het
Mcc	A	T	18: 44,442,918	I901N	probably benign	Het
Megf11	T	G	9: 64,638,450	C172G	probably damaging	Het
Mipol1	A	G	12: 57,306,034	Y53C	probably benign	Het
Nectin4	C	T	1: 171,385,683	T391I	probably damaging	Het
Nell2	A	T	15: 95,385,076	Y362N	possibly damaging	Het
Nphp4	T	C	4: 152,544,461		probably null	Het
Nsun4	A	G	4: 116,034,276	V302A	probably benign	Het
Olfr1076	T	C	2: 86,508,510	I17T	probably damaging	Het
Opn1sw	A	G	6: 29,378,001	S328P	possibly damaging	Het
Pga5	C	T	19: 10,669,533	G303S	probably damaging	Het
Pik3c2g	T	A	6: 139,882,016	Y712*	probably null	Het
Pkd1	C	T	17: 24,575,926	R2196C	probably damaging	Het
Pkd1l3	TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA	TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA	8: 109,623,969		probably benign	Het
Plekhm2	A	T	4: 141,632,301	M385K	probably damaging	Het
Pole	T	C	5: 110,291,026	V164A	possibly damaging	Het
Prr19	T	A	7: 25,302,910	F11Y	probably damaging	Het
Prtg	G	T	9: 72,849,861	L355F	probably benign	Het
Raph1	C	A	1: 60,525,670	M219I	unknown	Het
Rtkn2	A	G	10: 68,003,264	D140G	possibly damaging	Het
Serpina5	T	C	12: 104,103,872	S343P	probably damaging	Het
Slc1a1	A	G	19: 28,911,725	K466R	probably benign	Het
Slc43a1	G	A	2: 84,860,162	V518M	probably damaging	Het
Slc47a2	A	G	11: 61,336,923	L125P	probably damaging	Het
Slc4a7	C	A	14: 14,766,803	C585*	probably null	Het
Snx19	A	G	9: 30,435,900	E713G	probably damaging	Het
Tiam1	C	T	16: 89,858,673	V715M	probably damaging	Het
Tln2	T	A	9: 67,370,761	M322L	probably benign	Het
Top2a	G	A	11: 99,011,058	R449*	probably null	Het
Trpv4	C	A	5: 114,658,413		probably benign	Het
Vmn1r214	A	C	13: 23,034,925	R196S	probably benign	Het
Vmn1r43	A	T	6: 89,869,570	H311Q	possibly damaging	Het
Vmn1r54	A	G	6: 90,270,027	T308A	probably benign	Het
Zfand3	T	A	17: 30,135,505	Y99N	probably benign	Het
Zfp119b	T	C	17: 55,939,355	Y277C	probably damaging	Het
Zfp345	G	A	2: 150,472,583	H345Y	possibly damaging	Het
Zyg11a	T	C	4: 108,189,729	E516G	probably damaging	Het

Other mutations in Odf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01472:Odf2	APN	2	29893059	missense	probably damaging	1.00
IGL01511:Odf2	APN	2	29914309	splice site	probably benign
IGL01760:Odf2	APN	2	29914460	missense	probably damaging	1.00
IGL02487:Odf2	APN	2	29920839	missense	possibly damaging	0.80
IGL03047:Odf2	APN	2	29920895	splice site	probably benign
IGL03057:Odf2	APN	2	29923645	intron	probably benign
IGL03064:Odf2	APN	2	29901079	missense	probably benign	0.28
3-1:Odf2	UTSW	2	29904075	nonsense	probably null
IGL02837:Odf2	UTSW	2	29926713	missense	probably damaging	0.99
R4025:Odf2	UTSW	2	29926815	missense	probably damaging	1.00
R4227:Odf2	UTSW	2	29901284	intron	probably benign
R4357:Odf2	UTSW	2	29892244	missense	probably benign	0.00
R4417:Odf2	UTSW	2	29915321	splice site	probably benign
R4512:Odf2	UTSW	2	29926097	splice site	probably null
R4705:Odf2	UTSW	2	29904034	missense	probably damaging	1.00
R4815:Odf2	UTSW	2	29902240	missense	possibly damaging	0.87
R5325:Odf2	UTSW	2	29912571	missense	probably benign	0.19
R5614:Odf2	UTSW	2	29920867	missense	probably damaging	0.99
R6998:Odf2	UTSW	2	29912617	missense	probably benign	0.43
R7740:Odf2	UTSW	2	29930624	missense	probably damaging	1.00
R7963:Odf2	UTSW	2	29926100	missense	probably benign	0.44
R8548:Odf2	UTSW	2	29893514	critical splice donor site	probably null
R9096:Odf2	UTSW	2	29893496	missense	probably damaging	1.00
R9157:Odf2	UTSW	2	29926803	missense	probably benign	0.05
R9313:Odf2	UTSW	2	29926803	missense	probably benign	0.05
R9658:Odf2	UTSW	2	29889801	missense	probably benign	0.01
R9722:Odf2	UTSW	2	29923582	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- GCAAATAAGTACACTTCCGTCCG -3'
(R):5'- CCCAGCATGGTGGAAACTTAAG -3'

Sequencing Primer
(F):5'- GGCTTGGCCTTAGCAGCTTATC -3'
(R):5'- TGGAAACTTAAGCTGCCTGC -3'

Posted On

2022-04-18