Incidental Mutation 'R9393:Unkl'
ID 710711
Institutional Source Beutler Lab
Gene Symbol Unkl
Ensembl Gene ENSMUSG00000015127
Gene Name unkempt family like zinc finger
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock # R9393 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 25188397-25234443 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25229418 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 322 (S322P)
Ref Sequence ENSEMBL: ENSMUSP00000124276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015271] [ENSMUST00000038973] [ENSMUST00000039734] [ENSMUST00000115154] [ENSMUST00000160896] [ENSMUST00000161679] [ENSMUST00000162498]
AlphaFold Q5FWH2
Predicted Effect probably benign
Transcript: ENSMUST00000015271
SMART Domains Protein: ENSMUSP00000015271
Gene: ENSMUSG00000015127

DomainStartEndE-ValueType
coiled coil region 73 154 N/A INTRINSIC
RING 198 232 4.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038973
SMART Domains Protein: ENSMUSP00000042073
Gene: ENSMUSG00000035521

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PRKCSH 69 152 1.4e-10 PFAM
DMAP_binding 176 278 2.55e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000039734
AA Change: S508P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039670
Gene: ENSMUSG00000015127
AA Change: S508P

DomainStartEndE-ValueType
low complexity region 61 69 N/A INTRINSIC
ZnF_C3H1 76 103 1.33e-1 SMART
Blast:ZnF_C3H1 115 144 7e-13 BLAST
ZnF_C3H1 207 232 2.49e1 SMART
ZnF_C3H1 243 276 9.28e-1 SMART
ZnF_C3H1 285 312 8.47e-4 SMART
low complexity region 371 412 N/A INTRINSIC
low complexity region 463 495 N/A INTRINSIC
low complexity region 499 505 N/A INTRINSIC
low complexity region 511 527 N/A INTRINSIC
coiled coil region 561 642 N/A INTRINSIC
RING 686 720 4.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115154
SMART Domains Protein: ENSMUSP00000110807
Gene: ENSMUSG00000035521

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PRKCSH 69 151 3.9e-11 PFAM
DMAP_binding 183 285 2.55e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160896
AA Change: S322P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124276
Gene: ENSMUSG00000015127
AA Change: S322P

DomainStartEndE-ValueType
ZnF_C3H1 21 46 2.49e1 SMART
ZnF_C3H1 57 90 9.28e-1 SMART
ZnF_C3H1 99 126 8.47e-4 SMART
low complexity region 185 226 N/A INTRINSIC
low complexity region 277 309 N/A INTRINSIC
low complexity region 313 319 N/A INTRINSIC
low complexity region 325 341 N/A INTRINSIC
coiled coil region 375 456 N/A INTRINSIC
RING 500 534 4.13e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161679
AA Change: S12P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125294
Gene: ENSMUSG00000015127
AA Change: S12P

DomainStartEndE-ValueType
low complexity region 3 9 N/A INTRINSIC
low complexity region 15 31 N/A INTRINSIC
coiled coil region 65 146 N/A INTRINSIC
RING 190 224 4.13e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162498
AA Change: S96P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124530
Gene: ENSMUSG00000015127
AA Change: S96P

DomainStartEndE-ValueType
low complexity region 51 83 N/A INTRINSIC
low complexity region 87 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RING finger protein that may function in Rac signaling. It can bind to Brg/Brm-associated factor 60b and can promote its ubiquitination. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik A G 10: 82,622,641 S59P unknown Het
4933406M09Rik A G 1: 134,390,858 D456G probably benign Het
A2m A G 6: 121,639,311 S133G possibly damaging Het
Agps A G 2: 75,904,912 E567G possibly damaging Het
Ak9 T C 10: 41,409,072 I1381T unknown Het
Apcdd1 C T 18: 62,922,660 probably benign Het
Arrb1 T A 7: 99,589,684 C150S probably damaging Het
Asz1 T C 6: 18,051,331 I450V probably benign Het
Atp10b A G 11: 43,172,781 N181S probably damaging Het
Bptf A C 11: 107,074,308 D1353E probably benign Het
Cacna2d1 T C 5: 15,935,015 M1T probably null Het
Ccdc106 T A 7: 5,056,201 I6N possibly damaging Het
Celf6 A T 9: 59,603,242 Q252L probably benign Het
Colgalt2 A T 1: 152,484,847 K212* probably null Het
Cryba4 T C 5: 112,246,766 S166G probably benign Het
Cyp2w1 A G 5: 139,356,280 E123G probably benign Het
Cyp4a10 G C 4: 115,525,369 K285N probably damaging Het
Cyth1 G T 11: 118,183,884 T197K probably benign Het
Ddhd1 A G 14: 45,657,228 W262R probably damaging Het
Dnah8 T A 17: 30,653,387 V450D possibly damaging Het
Eml5 C T 12: 98,876,174 V222I probably benign Het
Fam160b2 G A 14: 70,594,023 Q24* probably null Het
Fbxw19 A G 9: 109,495,805 S15P probably damaging Het
Fignl2 C A 15: 101,053,585 R272L unknown Het
Gm10842 A T 11: 105,147,059 D56V unknown Het
Gm21818 A T 13: 120,173,422 Y80F probably benign Het
Gmps T A 3: 63,993,219 N305K probably benign Het
Gnai1 A T 5: 18,360,057 L38Q Het
Golim4 A T 3: 75,878,157 D642E probably benign Het
Gp1ba A T 11: 70,640,467 Q353L unknown Het
Gpnmb T C 6: 49,048,062 S343P possibly damaging Het
Hexb G A 13: 97,176,828 R507* probably null Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Khsrp T C 17: 57,023,350 Y585C probably damaging Het
Kif21a A T 15: 90,969,778 D795E probably benign Het
Klkb1 A T 8: 45,276,355 V309E probably benign Het
Krtap9-1 C A 11: 99,873,838 C133* probably null Het
Krtcap2 T C 3: 89,246,271 probably benign Het
Lilra5 T C 7: 4,237,759 M1T probably null Het
Magi1 G A 6: 93,682,909 T1019I probably benign Het
Mdn1 T A 4: 32,713,825 H1967Q Het
Mroh2b A T 15: 4,951,184 T1412S probably benign Het
Myh13 A T 11: 67,352,068 M936L probably benign Het
Ncapd3 A G 9: 27,051,386 T373A possibly damaging Het
Noc2l T C 4: 156,236,327 probably null Het
Nrg4 C T 9: 55,242,136 S59N probably benign Het
Nrip1 A G 16: 76,294,465 V68A probably benign Het
Olfr739 T C 14: 50,424,798 V93A probably benign Het
Olfr825 T C 10: 130,163,147 T60A probably benign Het
Pcdhga6 G T 18: 37,707,159 probably benign Het
Phf20l1 A G 15: 66,604,106 N196S probably damaging Het
Ppp4r4 T A 12: 103,605,037 Y787* probably null Het
Psma8 G A 18: 14,706,241 R4Q probably null Het
Reg4 A G 3: 98,229,852 K46E probably benign Het
Rnf14 T A 18: 38,309,627 M327K possibly damaging Het
Rtn1 A T 12: 72,216,812 Y753* probably null Het
Slc26a11 A G 11: 119,368,801 R275G probably benign Het
Stard9 A G 2: 120,688,175 T527A possibly damaging Het
Stk26 C T X: 50,841,741 probably benign Het
Tas1r1 C T 4: 152,031,956 C407Y probably damaging Het
Tenm3 A G 8: 48,674,524 S40P probably damaging Het
Tespa1 T A 10: 130,347,197 S4T probably damaging Het
Tlr11 A G 14: 50,362,090 N511S probably benign Het
Tmem28 C T X: 99,845,491 R321W probably damaging Het
Tmprss15 A G 16: 78,957,323 I1014T probably benign Het
Tpte T A 8: 22,284,974 M20K probably benign Het
Ttn A G 2: 76,782,046 V17199A possibly damaging Het
Tubgcp3 A G 8: 12,653,411 Y305H probably damaging Het
Ubr4 T A 4: 139,485,302 V5081E unknown Het
Vav3 T A 3: 109,578,366 probably null Het
Vmn1r76 A G 7: 11,930,838 S150P probably benign Het
Xpot A G 10: 121,609,695 probably null Het
Xylt1 A G 7: 117,643,679 I650V probably benign Het
Zan C A 5: 137,405,420 A3955S unknown Het
Other mutations in Unkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Unkl APN 17 25210848 missense probably benign 0.00
IGL02011:Unkl APN 17 25218591 missense probably damaging 1.00
IGL02141:Unkl APN 17 25229434 missense probably damaging 1.00
R0226:Unkl UTSW 17 25230711 missense probably damaging 0.96
R0394:Unkl UTSW 17 25230777 critical splice donor site probably null
R0638:Unkl UTSW 17 25208083 splice site probably benign
R1364:Unkl UTSW 17 25189623 missense probably benign
R1596:Unkl UTSW 17 25205733 missense probably null 1.00
R1899:Unkl UTSW 17 25229460 splice site probably null
R1960:Unkl UTSW 17 25209645 splice site probably benign
R3774:Unkl UTSW 17 25188407 splice site probably null
R3927:Unkl UTSW 17 25229329 missense probably damaging 0.99
R5164:Unkl UTSW 17 25213109 splice site probably null
R5481:Unkl UTSW 17 25201172 nonsense probably null
R5520:Unkl UTSW 17 25205610 missense probably damaging 1.00
R5559:Unkl UTSW 17 25205713 missense probably benign 0.00
R6267:Unkl UTSW 17 25231865 makesense probably null
R6296:Unkl UTSW 17 25231865 makesense probably null
R6883:Unkl UTSW 17 25230333 missense probably damaging 1.00
R6979:Unkl UTSW 17 25199916 missense probably damaging 1.00
R7752:Unkl UTSW 17 25218653 missense probably damaging 1.00
R7901:Unkl UTSW 17 25218653 missense probably damaging 1.00
R8712:Unkl UTSW 17 25231715 missense possibly damaging 0.63
R9170:Unkl UTSW 17 25229376 missense probably benign 0.00
R9331:Unkl UTSW 17 25231749 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGTTCCATGGCAGAAGC -3'
(R):5'- CCGCTATGTCACATAGGTTGG -3'

Sequencing Primer
(F):5'- AAGCCCTGCCTGCCCTTG -3'
(R):5'- CTATGTCACATAGGTTGGAGTGG -3'
Posted On 2022-04-18