Mutagenetix > Incidental Mutation

Incidental Mutation 'R0767:Kiz'

71466

Institutional Source

Beutler Lab

Gene Symbol

Kiz

Ensembl Gene

ENSMUSG00000074749

Gene Name

kizuna centrosomal protein

Synonyms

Plk1s1, Ncrna00153, LOC228730, Gm114

MMRRC Submission

038947-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0767 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

146697784-146812017 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 146730971 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 154 (T154S)

Ref Sequence

ENSEMBL: ENSMUSP00000096884 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099278] [ENSMUST00000156232]

AlphaFold

Q3UXL4

Predicted Effect

probably damaging
Transcript: ENSMUST00000099278
AA Change: T154S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096884
Gene: ENSMUSG00000074749
AA Change: T154S

Domain	Start	End	E-Value	Type
low complexity region	3	11	N/A	INTRINSIC
low complexity region	15	26	N/A	INTRINSIC
low complexity region	60	75	N/A	INTRINSIC
coiled coil region	102	132	N/A	INTRINSIC
low complexity region	302	313	N/A	INTRINSIC
low complexity region	376	399	N/A	INTRINSIC
low complexity region	632	646	N/A	INTRINSIC
low complexity region	679	694	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000156232
AA Change: T127S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000121952
Gene: ENSMUSG00000074749
AA Change: T127S

Domain	Start	End	E-Value	Type
low complexity region	3	11	N/A	INTRINSIC
low complexity region	15	26	N/A	INTRINSIC
low complexity region	60	75	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.8%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to centrosomes, strengthening and stabilizing the pericentriolar region prior to spindle formation. The encoded protein usually remains with the mother centrosome after centrosomal duplication. Sevral transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutants with truncated C-term transcript were normal size and weight, bred normally with normal litter size, and no obvious defects during fetal or adult development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 4 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ccdc106	G	A	7: 5,062,539 (GRCm39)	D11N	possibly damaging	Het
Pfkp	C	T	13: 6,655,048 (GRCm39)	V344M	probably damaging	Het
Polr3a	G	A	14: 24,534,232 (GRCm39)	P91L	probably damaging	Het
Sis	T	C	3: 72,859,864 (GRCm39)	Q297R	probably damaging	Het

Other mutations in Kiz

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01448:Kiz	APN	2	146,705,721 (GRCm39)	missense	probably benign	0.22
IGL01649:Kiz	APN	2	146,731,229 (GRCm39)	missense	probably benign	0.35
IGL02184:Kiz	APN	2	146,731,520 (GRCm39)	missense	probably benign	0.20
IGL02500:Kiz	APN	2	146,705,733 (GRCm39)	missense	probably benign	0.06
IGL02548:Kiz	APN	2	146,712,690 (GRCm39)	missense	probably damaging	0.99
R0284:Kiz	UTSW	2	146,705,730 (GRCm39)	missense	probably benign	0.22
R0364:Kiz	UTSW	2	146,784,076 (GRCm39)	missense	probably benign	0.20
R0478:Kiz	UTSW	2	146,784,078 (GRCm39)	missense	possibly damaging	0.93
R0685:Kiz	UTSW	2	146,697,978 (GRCm39)	splice site	probably benign
R0866:Kiz	UTSW	2	146,697,973 (GRCm39)	splice site	probably benign
R1180:Kiz	UTSW	2	146,811,927 (GRCm39)	missense	unknown
R2037:Kiz	UTSW	2	146,811,880 (GRCm39)	missense	probably damaging	1.00
R2055:Kiz	UTSW	2	146,733,203 (GRCm39)	missense	probably benign	0.10
R2877:Kiz	UTSW	2	146,731,476 (GRCm39)	missense	possibly damaging	0.75
R4780:Kiz	UTSW	2	146,731,166 (GRCm39)	missense	possibly damaging	0.90
R4822:Kiz	UTSW	2	146,732,989 (GRCm39)	missense	probably damaging	1.00
R4835:Kiz	UTSW	2	146,784,008 (GRCm39)	missense	probably damaging	1.00
R5004:Kiz	UTSW	2	146,811,899 (GRCm39)	missense	possibly damaging	0.83
R5473:Kiz	UTSW	2	146,811,915 (GRCm39)	nonsense	probably null
R5878:Kiz	UTSW	2	146,731,521 (GRCm39)	missense	probably damaging	0.99
R6216:Kiz	UTSW	2	146,731,417 (GRCm39)	missense	probably damaging	1.00
R6222:Kiz	UTSW	2	146,732,981 (GRCm39)	missense	probably damaging	1.00
R7144:Kiz	UTSW	2	146,792,430 (GRCm39)	splice site	probably null
R7475:Kiz	UTSW	2	146,733,006 (GRCm39)	missense	possibly damaging	0.90
R7580:Kiz	UTSW	2	146,798,169 (GRCm39)	missense	probably damaging	0.99
R7848:Kiz	UTSW	2	146,731,100 (GRCm39)	missense	probably benign	0.19
R8395:Kiz	UTSW	2	146,794,949 (GRCm39)	missense	possibly damaging	0.79
R8513:Kiz	UTSW	2	146,712,684 (GRCm39)	critical splice acceptor site	probably null
R8933:Kiz	UTSW	2	146,784,037 (GRCm39)	missense
R9146:Kiz	UTSW	2	146,705,740 (GRCm39)	missense	probably benign	0.39
R9352:Kiz	UTSW	2	146,794,927 (GRCm39)	missense	probably damaging	0.99
RF021:Kiz	UTSW	2	146,712,750 (GRCm39)	missense	possibly damaging	0.74
Z1177:Kiz	UTSW	2	146,777,747 (GRCm39)	missense	possibly damaging	0.59

Predicted Primers

PCR Primer
(F):5'- TAATCTGGACTGTAGCGGAGCTGG -3'
(R):5'- TTCTGAAGCTGCCATCATGGGGAC -3'

Sequencing Primer
(F):5'- CTGGCTAATTCATTAAGTGGGAG -3'
(R):5'- CTTCTCACCAGTCTGAAGAGATG -3'

Posted On

2013-09-30