Incidental Mutation 'R6222:Kiz'
ID504067
Institutional Source Beutler Lab
Gene Symbol Kiz
Ensembl Gene ENSMUSG00000074749
Gene Namekizuna centrosomal protein
SynonymsPlk1s1, LOC228730, Ncrna00153, Gm114
MMRRC Submission 044353-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6222 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location146855864-146970097 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 146891061 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 386 (S386C)
Ref Sequence ENSEMBL: ENSMUSP00000096884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099278] [ENSMUST00000156232]
Predicted Effect probably damaging
Transcript: ENSMUST00000099278
AA Change: S386C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096884
Gene: ENSMUSG00000074749
AA Change: S386C

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 15 26 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
coiled coil region 102 132 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 376 399 N/A INTRINSIC
low complexity region 632 646 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156232
SMART Domains Protein: ENSMUSP00000121952
Gene: ENSMUSG00000074749

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 15 26 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to centrosomes, strengthening and stabilizing the pericentriolar region prior to spindle formation. The encoded protein usually remains with the mother centrosome after centrosomal duplication. Sevral transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutants with truncated C-term transcript were normal size and weight, bred normally with normal litter size, and no obvious defects during fetal or adult development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T C 14: 35,809,966 *217W probably null Het
Abcc3 A G 11: 94,368,605 F337L probably benign Het
Abcc4 T A 14: 118,529,956 H903L probably damaging Het
Akap7 T A 10: 25,283,946 K119* probably null Het
Als2 T C 1: 59,180,125 D1222G probably benign Het
Ano4 T C 10: 89,027,222 Y296C probably damaging Het
Arid1b A G 17: 5,327,647 probably null Het
Arl10 T C 13: 54,578,831 F141L probably damaging Het
B130006D01Rik T C 11: 95,726,162 probably benign Het
Bbs9 T A 9: 22,567,851 S197T possibly damaging Het
Bicd1 A T 6: 149,512,965 D392V probably damaging Het
Bmi1 T A 2: 18,683,702 M168K possibly damaging Het
C7 A T 15: 5,011,941 D494E possibly damaging Het
Cacna1s A T 1: 136,104,622 N1221I probably benign Het
Cacng7 A G 7: 3,336,612 T10A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdpf1 T C 15: 85,807,442 R108G possibly damaging Het
Ceacam5 A T 7: 17,745,547 K196N probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Cma2 T C 14: 55,973,192 I112T possibly damaging Het
Cntnap4 A G 8: 112,842,721 S916G probably damaging Het
Cwf19l2 T A 9: 3,454,569 Y627* probably null Het
Dusp27 G T 1: 166,098,645 Q1133K probably benign Het
Fam204a A G 19: 60,199,968 probably null Het
Galnt1 T A 18: 24,264,534 probably null Het
Gbe1 T C 16: 70,529,012 probably null Het
Gm5771 A T 6: 41,397,166 Y234F probably damaging Het
Gm6871 C T 7: 41,546,582 D244N probably damaging Het
Gna15 T C 10: 81,512,046 T189A probably damaging Het
Igsf10 C T 3: 59,318,915 D2446N possibly damaging Het
Ing2 T C 8: 47,668,931 K194R possibly damaging Het
Ino80d G A 1: 63,058,525 H737Y probably damaging Het
Izumo4 C T 10: 80,703,051 R83W probably damaging Het
Kcnt1 G A 2: 25,892,510 V219M probably damaging Het
Ldlrap1 C T 4: 134,757,360 E108K probably damaging Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfr1186 T C 2: 88,499,270 Y62H probably benign Het
Olfr1368 T C 13: 21,142,877 Y60C probably damaging Het
Pdzd2 T C 15: 12,374,566 K1828E probably damaging Het
Prl3a1 T C 13: 27,276,114 F194L probably benign Het
Reg1 A T 6: 78,427,374 Q77L probably benign Het
Ruvbl2 G T 7: 45,424,725 D248E probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Serpinb5 T A 1: 106,870,340 C20S probably benign Het
Sh2d4b A C 14: 40,820,737 S361A probably damaging Het
Snx2 T A 18: 53,199,824 L190* probably null Het
Sorcs3 A T 19: 48,759,857 Y755F possibly damaging Het
Tiam2 A G 17: 3,453,338 Q930R probably damaging Het
Tll1 C A 8: 64,098,534 G271V probably benign Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem181a T C 17: 6,300,917 V367A probably benign Het
Umodl1 T C 17: 31,002,892 probably null Het
Virma C T 4: 11,527,820 A1187V probably damaging Het
Wdr53 T C 16: 32,256,664 V229A probably benign Het
Zcchc10 T C 11: 53,332,462 probably benign Het
Other mutations in Kiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Kiz APN 2 146863801 missense probably benign 0.22
IGL01649:Kiz APN 2 146889309 missense probably benign 0.35
IGL02184:Kiz APN 2 146889600 missense probably benign 0.20
IGL02500:Kiz APN 2 146863813 missense probably benign 0.06
IGL02548:Kiz APN 2 146870770 missense probably damaging 0.99
R0284:Kiz UTSW 2 146863810 missense probably benign 0.22
R0364:Kiz UTSW 2 146942156 missense probably benign 0.20
R0478:Kiz UTSW 2 146942158 missense possibly damaging 0.93
R0685:Kiz UTSW 2 146856058 splice site probably benign
R0767:Kiz UTSW 2 146889051 missense probably damaging 1.00
R0866:Kiz UTSW 2 146856053 splice site probably benign
R1180:Kiz UTSW 2 146970007 missense unknown
R2037:Kiz UTSW 2 146969960 missense probably damaging 1.00
R2055:Kiz UTSW 2 146891283 missense probably benign 0.10
R2877:Kiz UTSW 2 146889556 missense possibly damaging 0.75
R4780:Kiz UTSW 2 146889246 missense possibly damaging 0.90
R4822:Kiz UTSW 2 146891069 missense probably damaging 1.00
R4835:Kiz UTSW 2 146942088 missense probably damaging 1.00
R5004:Kiz UTSW 2 146969979 missense possibly damaging 0.83
R5473:Kiz UTSW 2 146969995 nonsense probably null
R5878:Kiz UTSW 2 146889601 missense probably damaging 0.99
R6216:Kiz UTSW 2 146889497 missense probably damaging 1.00
R7144:Kiz UTSW 2 146950510 splice site probably null
R7475:Kiz UTSW 2 146891086 missense possibly damaging 0.90
R7580:Kiz UTSW 2 146956249 missense probably damaging 0.99
R7848:Kiz UTSW 2 146889180 missense probably benign 0.19
R8395:Kiz UTSW 2 146953029 missense possibly damaging 0.79
R8513:Kiz UTSW 2 146870764 critical splice acceptor site probably null
RF021:Kiz UTSW 2 146870830 missense possibly damaging 0.74
Z1177:Kiz UTSW 2 146935827 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- CCTCTGCTGAGATCAAAGGTGTG -3'
(R):5'- GGAAAGCTTTGGGTCTGTAAAAC -3'

Sequencing Primer
(F):5'- CTGAGATCAAAGGTGTGCATCAC -3'
(R):5'- CATATTCCGTGAAGAGCGAATC -3'
Posted On2018-02-28