Incidental Mutation 'R9483:Mgat3'
ID 716397
Institutional Source Beutler Lab
Gene Symbol Mgat3
Ensembl Gene ENSMUSG00000042428
Gene Name mannoside acetylglucosaminyltransferase 3
Synonyms GnT-III, 1110038J12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock # R9483 (G1)
Quality Score 166.009
Status Not validated
Chromosome 15
Chromosomal Location 80173721-80215519 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 80211440 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 156 (V156E)
Ref Sequence ENSEMBL: ENSMUSP00000043077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044970]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000044970
AA Change: V156E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043077
Gene: ENSMUSG00000042428
AA Change: V156E

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
Pfam:Glyco_transf_17 191 362 3.2e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are believed to be over 100 different glycosyltransferases involved in the synthesis of protein-bound and lipid-bound oligosaccharides. The enzyme encoded by this gene transfers a GlcNAc residue to the beta-linked mannose of the trimannosyl core of N-linked oligosaccharides and produces a bisecting GlcNAc. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced DEN and PB-induced hepatic tumors and reduced hepatocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T G 1: 37,631,415 E148A probably damaging Het
2900026A02Rik A T 5: 113,191,144 M334K probably benign Het
Abca1 A T 4: 53,060,351 I1525N probably benign Het
Abca4 A T 3: 122,085,626 I398F Het
Acbd3 A G 1: 180,745,156 D327G probably benign Het
Acsm3 A G 7: 119,783,943 T544A probably damaging Het
Atp11a C T 8: 12,851,087 T972M probably damaging Het
Cbfb C T 8: 105,202,491 R147* probably null Het
Ccdc17 G T 4: 116,596,947 R54L probably benign Het
Cuedc2 G T 19: 46,330,960 A223E probably benign Het
Cul5 T C 9: 53,621,174 I787V probably benign Het
D430041D05Rik T A 2: 104,257,218 H471L probably benign Het
Ddx39 T C 8: 83,722,287 Y264H probably benign Het
Dlgap3 C A 4: 127,233,872 R778S probably damaging Het
Esrrg T C 1: 188,198,651 V313A probably damaging Het
Fam124a T C 14: 62,606,651 I536T probably damaging Het
Fbxo21 T C 5: 117,989,207 F275L possibly damaging Het
Gabrg1 C A 5: 70,842,215 G2V possibly damaging Het
Gcc1 G T 6: 28,418,090 A748D probably damaging Het
Gjb6 T C 14: 57,124,054 D250G probably benign Het
Gm44501 A T 17: 40,578,981 K129* probably null Het
Hmcn2 T G 2: 31,430,363 L3952R Het
Hpd A G 5: 123,174,472 I278T probably damaging Het
Igsf3 T C 3: 101,439,501 F584S probably damaging Het
Igsf3 T A 3: 101,439,588 F613Y probably damaging Het
Ik A G 18: 36,753,582 D369G probably benign Het
Ikbke A G 1: 131,270,982 L365P probably damaging Het
Il22ra2 A T 10: 19,632,794 Q190L possibly damaging Het
Itga6 T C 2: 71,849,490 V1033A probably benign Het
Kif18a T C 2: 109,289,687 Y112H probably damaging Het
Krt75 T C 15: 101,573,803 H10R probably benign Het
L3mbtl1 T A 2: 162,948,814 L93H probably benign Het
Lrfn1 G A 7: 28,458,758 C34Y probably damaging Het
Lrrc47 A T 4: 154,017,463 I396F probably damaging Het
Mtus2 A G 5: 148,295,490 D1120G possibly damaging Het
Muc5ac G T 7: 141,811,728 E2700* probably null Het
Nxpe5 A T 5: 138,230,329 probably benign Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr621-ps1 T C 7: 103,629,724 T79A probably damaging Het
Pcdhga4 T A 18: 37,686,693 S432T possibly damaging Het
Pdk4 T A 6: 5,486,716 M353L probably benign Het
Ppp1r13b T A 12: 111,833,776 K645N probably benign Het
Ppt1 A T 4: 122,857,574 D288V possibly damaging Het
Prkcb A G 7: 122,582,440 Y417C probably damaging Het
Prss22 A G 17: 23,996,747 I67T probably damaging Het
Rab29 T C 1: 131,867,770 V40A possibly damaging Het
Rae1 T C 2: 173,008,148 probably null Het
Rasa3 C T 8: 13,580,033 probably null Het
Rasgrp3 A G 17: 75,500,722 D258G probably benign Het
Rcc1 T A 4: 132,335,497 T208S probably benign Het
Rgs3 C A 4: 62,657,117 Y580* probably null Het
Rpe65 C T 3: 159,622,681 P405S probably damaging Het
Rsf1 GGCGGC GGCGGCGGCAGCGGC 7: 97,579,930 probably benign Het
Rsph4a A G 10: 33,914,422 E669G probably damaging Het
Rusc1 A T 3: 89,086,806 V964E probably benign Het
Rusc2 A G 4: 43,415,897 N401S probably damaging Het
Slc10a1 G T 12: 80,956,090 T258K probably damaging Het
Slc5a9 A G 4: 111,890,221 L323P probably damaging Het
Slc6a17 T A 3: 107,471,456 I637F possibly damaging Het
Slc8a2 A G 7: 16,152,855 E641G possibly damaging Het
Sptbn2 G T 19: 4,739,946 A1321S probably damaging Het
Ssh2 G T 11: 77,393,150 A77S possibly damaging Het
St13 G T 15: 81,366,386 N316K probably damaging Het
Taf10 A G 7: 105,743,855 M121T probably benign Het
Tcta T C 9: 108,305,743 T68A probably damaging Het
Timd2 A T 11: 46,687,062 Y81N probably damaging Het
Tln2 T C 9: 67,392,487 E161G probably damaging Het
Tmed10 T C 12: 85,350,847 I123V probably benign Het
Ttf1 T C 2: 29,079,480 probably null Het
Tubg1 A G 11: 101,126,060 D396G probably damaging Het
Uhmk1 A G 1: 170,207,344 probably null Het
Unc13a C T 8: 71,650,577 A922T probably benign Het
Usp24 T A 4: 106,362,182 V525E probably damaging Het
Usp28 C A 9: 49,035,737 Q823K probably damaging Het
Vldlr A T 19: 27,246,631 I764F probably benign Het
Vmn2r88 T C 14: 51,411,184 Y62H Het
Zfp423 T A 8: 87,781,097 N873I possibly damaging Het
Other mutations in Mgat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Mgat3 APN 15 80212433 missense probably damaging 1.00
IGL01134:Mgat3 APN 15 80212176 missense probably benign 0.17
R0077:Mgat3 UTSW 15 80212577 missense probably benign 0.00
R1171:Mgat3 UTSW 15 80211637 missense probably benign 0.26
R1885:Mgat3 UTSW 15 80211619 missense probably benign 0.25
R1886:Mgat3 UTSW 15 80211619 missense probably benign 0.25
R1986:Mgat3 UTSW 15 80212189 missense probably benign 0.04
R2125:Mgat3 UTSW 15 80211886 missense probably benign 0.00
R3081:Mgat3 UTSW 15 80211854 missense probably benign 0.33
R4819:Mgat3 UTSW 15 80212349 missense probably damaging 1.00
R4992:Mgat3 UTSW 15 80212542 missense probably benign
R5083:Mgat3 UTSW 15 80211298 missense possibly damaging 0.92
R5356:Mgat3 UTSW 15 80211610 missense possibly damaging 0.88
R5356:Mgat3 UTSW 15 80212454 missense probably damaging 1.00
R6508:Mgat3 UTSW 15 80212024 missense possibly damaging 0.90
R6784:Mgat3 UTSW 15 80212200 missense probably damaging 0.98
R7021:Mgat3 UTSW 15 80212454 missense probably damaging 1.00
R7056:Mgat3 UTSW 15 80211896 missense probably damaging 0.99
R7592:Mgat3 UTSW 15 80210992 missense probably damaging 0.96
R7774:Mgat3 UTSW 15 80211542 missense probably damaging 0.96
R7819:Mgat3 UTSW 15 80211772 nonsense probably null
R8559:Mgat3 UTSW 15 80212169 missense probably damaging 1.00
R8678:Mgat3 UTSW 15 80212271 missense possibly damaging 0.74
R9285:Mgat3 UTSW 15 80212337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTGCGGACACCCCTCTAC -3'
(R):5'- GTTGATGGCGTTGATAACCC -3'

Sequencing Primer
(F):5'- AACTGCACCGGGTGGACTTC -3'
(R):5'- GTTGATAACCCGCCTCGGTAC -3'
Posted On 2022-07-18