Incidental Mutation 'R9705:Ubb'
ID 729761
Institutional Source Beutler Lab
Gene Symbol Ubb
Ensembl Gene ENSMUSG00000019505
Gene Name ubiquitin B
Synonyms Ubb2
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.358) question?
Stock # R9705 (G1)
Quality Score 110.008
Status Not validated
Chromosome 11
Chromosomal Location 62442329-62444037 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62443375 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 135 (Y135C)
Ref Sequence ENSEMBL: ENSMUSP00000019649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019649] [ENSMUST00000136938]
AlphaFold P0CG49
Predicted Effect possibly damaging
Transcript: ENSMUST00000019649
AA Change: Y135C

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000019649
Gene: ENSMUSG00000019505
AA Change: Y135C

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
UBQ 77 148 2.14e-36 SMART
UBQ 153 224 2.14e-36 SMART
UBQ 229 300 2.14e-36 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000136938
AA Change: Y135C

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117361
Gene: ENSMUSG00000019505
AA Change: Y135C

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
UBQ 77 148 2.14e-36 SMART
UBQ 153 224 2.14e-36 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes ubiquitin, one of the most conserved proteins known. Ubiquitin has a major role in targeting cellular proteins for degradation by the 26S proteosome. It is also involved in the maintenance of chromatin structure, the regulation of gene expression, and the stress response. Ubiquitin is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin moiety fused to an unrelated protein. This gene consists of four direct repeats of the ubiquitin coding sequence with no spacer sequence. Consequently, the protein is expressed as a polyubiquitin precursor with a final amino acid after the last repeat. Pseudogenes of this gene are located on chromosomes 3 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Targeted disruption of this gene results in progressive degeneration of hypothalamic neurons accompanied by impaired hypothalamic control of energy balance and adult-onset obesity. Both genders are infertile due to a failure of germ cells to progress through meiosis I and hypogonadism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C T 1: 11,588,913 (GRCm39) P110L probably damaging Het
Aff1 T G 5: 103,932,276 (GRCm39) L298R possibly damaging Het
B4galt1 T C 4: 40,853,474 (GRCm39) K111R probably benign Het
Brap A G 5: 121,801,373 (GRCm39) T87A probably benign Het
C1qtnf6 T A 15: 78,411,493 (GRCm39) Q61L probably benign Het
Ccar2 C A 14: 70,380,383 (GRCm39) C399F probably damaging Het
Cdh15 C A 8: 123,591,024 (GRCm39) D424E probably damaging Het
Cemip2 G A 19: 21,784,788 (GRCm39) V424I probably damaging Het
Col4a4 G A 1: 82,465,313 (GRCm39) A954V unknown Het
Cul9 T G 17: 46,854,226 (GRCm39) T159P probably damaging Het
Cyp3a59 A G 5: 146,033,120 (GRCm39) E164G probably benign Het
Dnah11 A C 12: 118,094,770 (GRCm39) L766R probably damaging Het
Drd5 T C 5: 38,478,027 (GRCm39) V340A probably damaging Het
Ephb6 G A 6: 41,596,715 (GRCm39) E921K probably benign Het
Fam83e G A 7: 45,371,921 (GRCm39) R106K probably benign Het
Fsip2 A G 2: 82,823,634 (GRCm39) T6456A probably benign Het
H2ac1 A G 13: 24,118,728 (GRCm39) N95S probably benign Het
H2-M10.6 A G 17: 37,123,642 (GRCm39) N112S probably benign Het
Hectd4 A T 5: 121,448,744 (GRCm39) Y364F probably benign Het
Hoxc9 T A 15: 102,890,362 (GRCm39) M93K possibly damaging Het
Hsd17b4 A C 18: 50,324,791 (GRCm39) K668T probably benign Het
Inpp4b T C 8: 82,772,890 (GRCm39) V728A probably benign Het
Jph3 C T 8: 122,508,913 (GRCm39) R392W probably damaging Het
Krt79 T G 15: 101,839,196 (GRCm39) E424D probably benign Het
Mphosph10 T C 7: 64,027,031 (GRCm39) E594G possibly damaging Het
Mrm2 G A 5: 140,316,990 (GRCm39) R15W probably damaging Het
Neurl4 A T 11: 69,799,679 (GRCm39) D994V probably damaging Het
Ngef G A 1: 87,431,010 (GRCm39) P269L probably damaging Het
Odam T A 5: 88,037,228 (GRCm39) F141I probably benign Het
Or1j10 A G 2: 36,266,962 (GRCm39) Y58C probably damaging Het
Or56a3b T A 7: 104,770,841 (GRCm39) L59Q probably damaging Het
Pck1 T A 2: 173,000,170 (GRCm39) S534T possibly damaging Het
Pgm3 A G 9: 86,437,414 (GRCm39) F528L probably benign Het
Pi4ka A T 16: 17,099,815 (GRCm39) I1936N Het
Ptpn13 T C 5: 103,681,221 (GRCm39) L807S possibly damaging Het
Ramp2 T A 11: 101,137,369 (GRCm39) L31Q possibly damaging Het
Rars2 A T 4: 34,646,561 (GRCm39) K275N possibly damaging Het
Rusc2 A C 4: 43,424,936 (GRCm39) N1131T probably benign Het
Snapc1 G T 12: 74,015,150 (GRCm39) K161N probably damaging Het
Spag8 G A 4: 43,652,366 (GRCm39) H325Y possibly damaging Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Synpo2l C T 14: 20,710,989 (GRCm39) V773M probably damaging Het
Syt3 A G 7: 44,045,225 (GRCm39) D519G probably damaging Het
Tacc2 A G 7: 130,361,018 (GRCm39) Y459C probably damaging Het
Trp53tg5 T C 2: 164,313,208 (GRCm39) S156G probably benign Het
Vmn2r90 A G 17: 17,933,039 (GRCm39) I200V possibly damaging Het
Zfp27 C A 7: 29,595,342 (GRCm39) V208F possibly damaging Het
Other mutations in Ubb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03302:Ubb APN 11 62,443,243 (GRCm39) missense probably damaging 1.00
BB009:Ubb UTSW 11 62,443,611 (GRCm39) nonsense probably null
BB019:Ubb UTSW 11 62,443,611 (GRCm39) nonsense probably null
R1120:Ubb UTSW 11 62,443,009 (GRCm39) missense possibly damaging 0.94
R6223:Ubb UTSW 11 62,443,351 (GRCm39) missense possibly damaging 0.91
R6753:Ubb UTSW 11 62,442,353 (GRCm39) splice site probably null
R7932:Ubb UTSW 11 62,443,611 (GRCm39) nonsense probably null
R8201:Ubb UTSW 11 62,443,053 (GRCm39) missense probably benign 0.00
R8932:Ubb UTSW 11 62,442,979 (GRCm39) missense probably damaging 1.00
R9492:Ubb UTSW 11 62,442,984 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCGTGAAGACCCTGACC -3'
(R):5'- CTCCTTCTGGATGTTGTAATCAGAG -3'

Sequencing Primer
(F):5'- TGAAGACCCTGACCGGCAAG -3'
(R):5'- TGCTTGCCGGCAAAGATCAG -3'
Posted On 2022-10-06