Incidental Mutation 'R0959:Rchy1'
ID81760
Institutional Source Beutler Lab
Gene Symbol Rchy1
Ensembl Gene ENSMUSG00000029397
Gene Namering finger and CHY zinc finger domain containing 1
SynonymsZfp363, Pirh2, 6720407C15Rik, PRO1996
MMRRC Submission 039088-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R0959 (G1)
Quality Score213
Status Not validated
Chromosome5
Chromosomal Location91948904-91963068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91957617 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 82 (F82L)
Ref Sequence ENSEMBL: ENSMUSP00000031345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031345] [ENSMUST00000169948]
PDB Structure
Solution structure of the CHY zinc finger domain of the RING finger and CHY zinc finger domain-containing protein 1 from Mus musculus [SOLUTION NMR]
Solution structure of the RING domain of the RING finger and CHY zinc finger domain-containing protein 1 from Mus musculus [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000031345
AA Change: F82L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031345
Gene: ENSMUSG00000029397
AA Change: F82L

DomainStartEndE-ValueType
Pfam:zf-CHY 20 93 2.2e-24 PFAM
low complexity region 119 130 N/A INTRINSIC
RING 145 186 1.38e-7 SMART
Pfam:zinc_ribbon_6 191 249 6.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140670
Predicted Effect possibly damaging
Transcript: ENSMUST00000169948
AA Change: F42L

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131270
Gene: ENSMUSG00000029397
AA Change: F42L

DomainStartEndE-ValueType
PDB:2DKT|A 10 99 2e-41 PDB
RING 105 146 1.38e-7 SMART
Pfam:zinc_ribbon_6 150 210 3.1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202883
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 95.8%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein containing CHY-, CTCHY-, and RING-type zinc-fingers. The encoded protein functions as an E3 ubiquitin ligase, and mediates the degradation of target proteins such as p53. The activity of this protein is important in cell cycle regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mouse embryonic fibroblasts from mice homozygous for a knock-out allele exhibit decreased cellular sensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A G 7: 140,294,791 E394G probably damaging Het
Actl11 T C 9: 107,931,235 V919A probably damaging Het
Adam28 G A 14: 68,607,938 P761L possibly damaging Het
Aplf G A 6: 87,646,083 P338L probably benign Het
Arl5b T A 2: 15,073,131 I89N probably damaging Het
Asap2 T C 12: 21,247,319 V596A probably damaging Het
Baz1b T G 5: 135,244,222 F1400C probably damaging Het
Ccdc149 A T 5: 52,385,155 L365Q probably damaging Het
Ccdc60 A G 5: 116,180,811 S149P probably damaging Het
Ces1b A G 8: 93,068,147 C275R probably damaging Het
Creb3 T C 4: 43,563,509 L163P probably damaging Het
Dhx37 T G 5: 125,423,432 N570T probably benign Het
Epc1 T C 18: 6,453,657 N223D probably damaging Het
Gbp5 C T 3: 142,503,124 H143Y possibly damaging Het
Gfod1 A T 13: 43,303,429 D23E probably benign Het
Gm12169 A T 11: 46,536,420 R187* probably null Het
Gm7361 A T 5: 26,262,053 E223D possibly damaging Het
Izumo1 A G 7: 45,624,991 K161E probably damaging Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Lrp1b T C 2: 41,268,354 N1617S possibly damaging Het
Med13l A T 5: 118,754,285 E1924D possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtg2 T G 2: 180,083,428 S145A probably benign Het
Mug2 G A 6: 122,085,495 S1442N probably benign Het
Myo1b A T 1: 51,797,087 I315N probably damaging Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nsrp1 G A 11: 77,046,459 R304* probably null Het
Olfr444 G T 6: 42,955,752 V85L probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Parp4 T C 14: 56,648,119 F1552L unknown Het
Pigw G A 11: 84,878,207 H99Y probably benign Het
Ppp6r2 G A 15: 89,274,176 M444I possibly damaging Het
Reln A C 5: 22,227,628 F125V probably damaging Het
Riok1 G A 13: 38,057,173 E435K probably damaging Het
Rnf213 A G 11: 119,452,581 R3590G probably damaging Het
Scrib G C 15: 76,051,461 P1249A probably benign Het
Shc4 C T 2: 125,678,687 probably null Het
Slc12a2 T A 18: 57,904,378 I520N probably damaging Het
Slc26a5 A G 5: 21,816,961 I484T probably benign Het
Slc39a11 G T 11: 113,464,073 T110K probably benign Het
Snd1 T A 6: 28,884,971 S774T probably benign Het
Spata31d1c C T 13: 65,036,315 P557L probably damaging Het
Svs1 T A 6: 48,988,632 C525S possibly damaging Het
Tada1 A G 1: 166,388,629 D133G probably benign Het
Tg A T 15: 66,708,010 T1555S probably damaging Het
Thra A G 11: 98,753,629 E15G possibly damaging Het
Ttn T A 2: 76,795,096 I15128F probably damaging Het
Ube2r2 A G 4: 41,174,066 Y68C probably damaging Het
Uncx A T 5: 139,546,687 N169I probably damaging Het
Vmn2r100 A G 17: 19,523,524 Y483C possibly damaging Het
Xkr4 T C 1: 3,216,674 D431G probably damaging Het
Xylb C A 9: 119,380,025 A311E possibly damaging Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb39 C A 10: 127,743,062 H502N probably damaging Het
Zfp82 A G 7: 30,056,451 L402P probably damaging Het
Zpbp2 G A 11: 98,557,625 R256Q probably benign Het
Other mutations in Rchy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02471:Rchy1 APN 5 91957546 nonsense probably null
IGL02668:Rchy1 APN 5 91962718 start codon destroyed probably null 0.43
IGL03251:Rchy1 APN 5 91962643 missense probably benign 0.08
R0137:Rchy1 UTSW 5 91957599 missense probably benign 0.01
R1462:Rchy1 UTSW 5 91957882 missense probably damaging 1.00
R1462:Rchy1 UTSW 5 91957882 missense probably damaging 1.00
R1531:Rchy1 UTSW 5 91955615 critical splice acceptor site probably null
R1868:Rchy1 UTSW 5 91951903 missense probably damaging 0.99
R4350:Rchy1 UTSW 5 91957954 missense probably damaging 1.00
R4953:Rchy1 UTSW 5 91962628 critical splice donor site probably null
R6223:Rchy1 UTSW 5 91957967 missense probably damaging 1.00
R6345:Rchy1 UTSW 5 91957942 missense probably benign 0.08
R6546:Rchy1 UTSW 5 91957958 missense probably damaging 1.00
R8311:Rchy1 UTSW 5 91951903 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- cacagcaaATACACCATTGCCCAAA -3'
(R):5'- GGAAGTGCAGTGCATCAACTGTGAA -3'

Sequencing Primer
(F):5'- CCATTGCCCAAATGTACTGG -3'
(R):5'- GTGCATCAACTGTGAAAAACTC -3'
Posted On2013-11-08