Incidental Mutation 'R1073:Olfr228'
ID85517
Institutional Source Beutler Lab
Gene Symbol Olfr228
Ensembl Gene ENSMUSG00000111772
Gene Name
SynonymsMOR189-3, GA_x6K02T0101M-139-669
MMRRC Submission 039159-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R1073 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86481921-86487386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86483640 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 34 (I34T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000216534] [ENSMUST00000217292]
Predicted Effect probably damaging
Transcript: ENSMUST00000099883
AA Change: I34T

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097468
Gene: ENSMUSG00000075180
AA Change: I34T

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.5e-54 PFAM
Pfam:7tm_1 41 290 5.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215705
Predicted Effect probably damaging
Transcript: ENSMUST00000216534
AA Change: I34T

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217292
AA Change: I34T

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Meta Mutation Damage Score 0.3228 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 T C 4: 136,236,431 I334T probably damaging Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Cacna2d3 T A 14: 29,045,623 H765L probably damaging Het
Cngb1 A G 8: 95,303,567 probably null Het
Csmd1 C T 8: 16,358,463 probably benign Het
Cux1 A T 5: 136,252,541 probably null Het
D7Ertd443e T C 7: 134,270,218 K232R probably damaging Het
Dock6 A G 9: 21,846,518 S97P probably benign Het
Eml5 G A 12: 98,830,973 A1099V probably damaging Het
Gtf2h1 G A 7: 46,816,944 A472T probably damaging Het
Krt82 T A 15: 101,550,254 D117V probably damaging Het
Lrfn5 A G 12: 61,840,809 Y461C probably damaging Het
Mkl2 T A 16: 13,412,318 S956T possibly damaging Het
Mmrn2 G A 14: 34,396,294 probably null Het
Msrb3 T A 10: 120,784,136 S93C possibly damaging Het
Ncl AAAGCCTCCC AAAGCCTCCCAAGCCTCCC 1: 86,350,816 probably benign Het
Osbpl10 C T 9: 115,207,553 Q381* probably null Het
Pelp1 A G 11: 70,396,590 L464P probably damaging Het
Pigs A G 11: 78,335,605 D216G probably benign Het
Ptprk T C 10: 28,496,947 probably null Het
Pyroxd1 T C 6: 142,348,644 probably null Het
Ros1 T A 10: 52,046,125 D2284V probably damaging Het
Rptor T C 11: 119,743,891 S178P possibly damaging Het
Slc8a1 C T 17: 81,648,407 D401N probably damaging Het
Tas2r143 T C 6: 42,400,760 Y175H probably benign Het
Tdrd9 T C 12: 112,023,259 S502P probably damaging Het
Tmem38a A G 8: 72,580,103 H142R probably damaging Het
Tmem44 A G 16: 30,514,833 probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Umod A G 7: 119,464,741 V614A possibly damaging Het
Vmn2r5 A T 3: 64,491,305 L751* probably null Het
Wdr37 A T 13: 8,805,840 I489N probably damaging Het
Xdh T C 17: 73,939,836 T78A probably benign Het
Zfp866 A T 8: 69,767,622 probably benign Het
Other mutations in Olfr228
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Olfr228 APN 2 86483218 missense probably benign 0.05
IGL02136:Olfr228 APN 2 86483465 missense probably damaging 1.00
IGL02419:Olfr228 APN 2 86482915 missense probably damaging 0.99
IGL03008:Olfr228 APN 2 86483334 missense probably damaging 1.00
R0240:Olfr228 UTSW 2 86483386 missense possibly damaging 0.78
R0240:Olfr228 UTSW 2 86483386 missense possibly damaging 0.78
R1163:Olfr228 UTSW 2 86483238 missense probably damaging 1.00
R1505:Olfr228 UTSW 2 86483213 missense possibly damaging 0.94
R1806:Olfr228 UTSW 2 86483139 missense probably damaging 0.99
R1940:Olfr228 UTSW 2 86483359 nonsense probably null
R3025:Olfr228 UTSW 2 86483739 start codon destroyed probably null 1.00
R3037:Olfr228 UTSW 2 86483643 missense probably damaging 0.96
R5156:Olfr228 UTSW 2 86483018 nonsense probably null
R6459:Olfr228 UTSW 2 86483229 missense probably benign 0.23
R6472:Olfr228 UTSW 2 86483190 nonsense probably null
R6493:Olfr228 UTSW 2 86483221 missense possibly damaging 0.59
R6880:Olfr228 UTSW 2 86483725 missense probably benign
R7283:Olfr228 UTSW 2 86483139 missense probably damaging 0.99
R8113:Olfr228 UTSW 2 86483068 missense probably damaging 1.00
X0028:Olfr228 UTSW 2 86482890 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATAGCGGTCATAAGACATTGCAGACA -3'
(R):5'- TGAGACTGGATGACTTCTTGCCTAGAT -3'

Sequencing Primer
(F):5'- AACCAAGGTCAGTAGTAGCG -3'
(R):5'- TGGATGACTTCTTGCCTAGATATTAG -3'
Posted On2013-11-18