Incidental Mutation 'R1073:Wdr37'
ID85545
Institutional Source Beutler Lab
Gene Symbol Wdr37
Ensembl Gene ENSMUSG00000021147
Gene NameWD repeat domain 37
Synonyms3110035P10Rik, 4933417A01Rik
MMRRC Submission 039159-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1073 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location8802968-8871909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8805840 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 489 (I489N)
Ref Sequence ENSEMBL: ENSMUSP00000062174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021572] [ENSMUST00000054251]
Predicted Effect probably damaging
Transcript: ENSMUST00000021572
AA Change: I489N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021572
Gene: ENSMUSG00000021147
AA Change: I489N

DomainStartEndE-ValueType
coiled coil region 63 101 N/A INTRINSIC
WD40 145 185 9.75e-3 SMART
WD40 188 227 4.27e-8 SMART
WD40 272 311 1.06e-3 SMART
WD40 314 353 4.91e-8 SMART
WD40 358 396 2.38e-6 SMART
Blast:WD40 400 438 8e-17 BLAST
WD40 445 486 6.19e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000054251
AA Change: I489N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062174
Gene: ENSMUSG00000021147
AA Change: I489N

DomainStartEndE-ValueType
coiled coil region 63 101 N/A INTRINSIC
WD40 145 185 9.75e-3 SMART
WD40 188 227 4.27e-8 SMART
WD40 272 311 1.06e-3 SMART
WD40 314 353 4.91e-8 SMART
WD40 358 396 2.38e-6 SMART
Blast:WD40 400 438 8e-17 BLAST
WD40 445 486 6.19e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177537
Meta Mutation Damage Score 0.2266 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 T C 4: 136,236,431 I334T probably damaging Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Cacna2d3 T A 14: 29,045,623 H765L probably damaging Het
Cngb1 A G 8: 95,303,567 probably null Het
Csmd1 C T 8: 16,358,463 probably benign Het
Cux1 A T 5: 136,252,541 probably null Het
D7Ertd443e T C 7: 134,270,218 K232R probably damaging Het
Dock6 A G 9: 21,846,518 S97P probably benign Het
Eml5 G A 12: 98,830,973 A1099V probably damaging Het
Gtf2h1 G A 7: 46,816,944 A472T probably damaging Het
Krt82 T A 15: 101,550,254 D117V probably damaging Het
Lrfn5 A G 12: 61,840,809 Y461C probably damaging Het
Mkl2 T A 16: 13,412,318 S956T possibly damaging Het
Mmrn2 G A 14: 34,396,294 probably null Het
Msrb3 T A 10: 120,784,136 S93C possibly damaging Het
Ncl AAAGCCTCCC AAAGCCTCCCAAGCCTCCC 1: 86,350,816 probably benign Het
Olfr228 A G 2: 86,483,640 I34T probably damaging Het
Osbpl10 C T 9: 115,207,553 Q381* probably null Het
Pelp1 A G 11: 70,396,590 L464P probably damaging Het
Pigs A G 11: 78,335,605 D216G probably benign Het
Ptprk T C 10: 28,496,947 probably null Het
Pyroxd1 T C 6: 142,348,644 probably null Het
Ros1 T A 10: 52,046,125 D2284V probably damaging Het
Rptor T C 11: 119,743,891 S178P possibly damaging Het
Slc8a1 C T 17: 81,648,407 D401N probably damaging Het
Tas2r143 T C 6: 42,400,760 Y175H probably benign Het
Tdrd9 T C 12: 112,023,259 S502P probably damaging Het
Tmem38a A G 8: 72,580,103 H142R probably damaging Het
Tmem44 A G 16: 30,514,833 probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Umod A G 7: 119,464,741 V614A possibly damaging Het
Vmn2r5 A T 3: 64,491,305 L751* probably null Het
Xdh T C 17: 73,939,836 T78A probably benign Het
Zfp866 A T 8: 69,767,622 probably benign Het
Other mutations in Wdr37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdr37 APN 13 8820505 missense probably damaging 1.00
IGL00753:Wdr37 APN 13 8861174 missense probably damaging 1.00
IGL02479:Wdr37 APN 13 8842784 missense probably damaging 1.00
profound UTSW 13 8842728 critical splice donor site probably null
radical UTSW 13 8847674 unclassified probably null
R0885:Wdr37 UTSW 13 8835252 intron probably null
R1085:Wdr37 UTSW 13 8805928 missense probably damaging 1.00
R1537:Wdr37 UTSW 13 8837003 missense probably benign 0.01
R1538:Wdr37 UTSW 13 8836792 missense probably benign
R1541:Wdr37 UTSW 13 8820538 missense probably benign 0.26
R1868:Wdr37 UTSW 13 8836851 missense probably damaging 1.00
R2240:Wdr37 UTSW 13 8861232 start gained probably benign
R3815:Wdr37 UTSW 13 8853596 intron probably benign
R3817:Wdr37 UTSW 13 8853596 intron probably benign
R3818:Wdr37 UTSW 13 8853596 intron probably benign
R3819:Wdr37 UTSW 13 8853596 intron probably benign
R4721:Wdr37 UTSW 13 8854029 missense possibly damaging 0.89
R5080:Wdr37 UTSW 13 8847674 unclassified probably null
R6297:Wdr37 UTSW 13 8842728 critical splice donor site probably null
R6761:Wdr37 UTSW 13 8849648 missense probably benign 0.07
R7505:Wdr37 UTSW 13 8819935 missense probably damaging 1.00
R7840:Wdr37 UTSW 13 8836875 missense probably damaging 0.96
R7873:Wdr37 UTSW 13 8805933 missense probably damaging 0.99
R7923:Wdr37 UTSW 13 8836875 missense probably damaging 0.96
R7956:Wdr37 UTSW 13 8805933 missense probably damaging 0.99
R8081:Wdr37 UTSW 13 8835370 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTTCATGCAAGCTGGGCAC -3'
(R):5'- TGGCTCTGAAAGCCTTTTACCCTG -3'

Sequencing Primer
(F):5'- GGCACAATGTGAAAAGAACATATAC -3'
(R):5'- GAGTCACAGGTGCTTACATTAC -3'
Posted On2013-11-18