Mutagenetix > Incidental Mutations

Incidental Mutation 'R1073:Krt82'

85548

Institutional Source

Beutler Lab

Gene Symbol

Krt82

Ensembl Gene

ENSMUSG00000049548

Gene Name

keratin 82

Synonyms

Krt2-20

MMRRC Submission

039159-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.051) question?

Stock #

R1073 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101541214-101550667 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 101550254 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 117 (D117V)

Ref Sequence

ENSEMBL: ENSMUSP00000023713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023713] [ENSMUST00000023714]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023713
AA Change: D117V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000023713
Gene: ENSMUSG00000049548
AA Change: D117V

Domain	Start	End	E-Value	Type
low complexity region	38	57	N/A	INTRINSIC
Pfam:Keratin_2_head	61	114	6.1e-13	PFAM
Filament	117	428	1.32e-153	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000023714

SMART Domains

Protein: ENSMUSP00000023714
Gene: ENSMUSG00000048699

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	16	139	3.1e-24	PFAM
Filament	142	453	1.05e-179	SMART
low complexity region	465	522	N/A	INTRINSIC
low complexity region	527	535	N/A	INTRINSIC

Meta Mutation Damage Score

0.0831

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.5%
20x: 94.5%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this keratin appears to be a hair cuticle-specific keratin. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asap3	T	C	4: 136,236,431	I334T	probably damaging	Het
Atxn7l3	C	G	11: 102,292,435		probably benign	Het
Cacna2d3	T	A	14: 29,045,623	H765L	probably damaging	Het
Cngb1	A	G	8: 95,303,567		probably null	Het
Csmd1	C	T	8: 16,358,463		probably benign	Het
Cux1	A	T	5: 136,252,541		probably null	Het
D7Ertd443e	T	C	7: 134,270,218	K232R	probably damaging	Het
Dock6	A	G	9: 21,846,518	S97P	probably benign	Het
Eml5	G	A	12: 98,830,973	A1099V	probably damaging	Het
Gtf2h1	G	A	7: 46,816,944	A472T	probably damaging	Het
Lrfn5	A	G	12: 61,840,809	Y461C	probably damaging	Het
Mkl2	T	A	16: 13,412,318	S956T	possibly damaging	Het
Mmrn2	G	A	14: 34,396,294		probably null	Het
Msrb3	T	A	10: 120,784,136	S93C	possibly damaging	Het
Ncl	AAAGCCTCCC	AAAGCCTCCCAAGCCTCCC	1: 86,350,816		probably benign	Het
Olfr228	A	G	2: 86,483,640	I34T	probably damaging	Het
Osbpl10	C	T	9: 115,207,553	Q381*	probably null	Het
Pelp1	A	G	11: 70,396,590	L464P	probably damaging	Het
Pigs	A	G	11: 78,335,605	D216G	probably benign	Het
Ptprk	T	C	10: 28,496,947		probably null	Het
Pyroxd1	T	C	6: 142,348,644		probably null	Het
Ros1	T	A	10: 52,046,125	D2284V	probably damaging	Het
Rptor	T	C	11: 119,743,891	S178P	possibly damaging	Het
Slc8a1	C	T	17: 81,648,407	D401N	probably damaging	Het
Tas2r143	T	C	6: 42,400,760	Y175H	probably benign	Het
Tdrd9	T	C	12: 112,023,259	S502P	probably damaging	Het
Tmem38a	A	G	8: 72,580,103	H142R	probably damaging	Het
Tmem44	A	G	16: 30,514,833		probably benign	Het
Ugt2b38	T	G	5: 87,412,373	N361H	probably damaging	Het
Umod	A	G	7: 119,464,741	V614A	possibly damaging	Het
Vmn2r5	A	T	3: 64,491,305	L751*	probably null	Het
Wdr37	A	T	13: 8,805,840	I489N	probably damaging	Het
Xdh	T	C	17: 73,939,836	T78A	probably benign	Het
Zfp866	A	T	8: 69,767,622		probably benign	Het

Other mutations in Krt82

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Krt82	APN	15	101543378	missense	probably damaging	0.97
IGL01112:Krt82	APN	15	101545523	missense	probably damaging	1.00
IGL01820:Krt82	APN	15	101543452	splice site	probably benign
IGL02529:Krt82	APN	15	101550396	nonsense	probably null
IGL02894:Krt82	APN	15	101542720	missense	probably damaging	1.00
IGL02974:Krt82	APN	15	101550585	nonsense	probably null
IGL03263:Krt82	APN	15	101541872	missense	probably benign	0.00
R0268:Krt82	UTSW	15	101541713	missense	probably benign	0.02
R0385:Krt82	UTSW	15	101545593	missense	probably damaging	1.00
R0542:Krt82	UTSW	15	101545600	splice site	probably benign
R1601:Krt82	UTSW	15	101545153	missense	probably damaging	1.00
R1795:Krt82	UTSW	15	101543384	missense	possibly damaging	0.90
R1944:Krt82	UTSW	15	101548535	missense	probably damaging	1.00
R1974:Krt82	UTSW	15	101545162	missense	probably benign	0.00
R2049:Krt82	UTSW	15	101545156	missense	probably damaging	0.96
R2140:Krt82	UTSW	15	101545156	missense	probably damaging	0.96
R2851:Krt82	UTSW	15	101548435	missense	probably damaging	1.00
R2852:Krt82	UTSW	15	101548435	missense	probably damaging	1.00
R2853:Krt82	UTSW	15	101548435	missense	probably damaging	1.00
R3815:Krt82	UTSW	15	101550600	missense	probably damaging	1.00
R4324:Krt82	UTSW	15	101541747	missense	probably benign	0.00
R4798:Krt82	UTSW	15	101550488	missense	probably benign	0.01
R4980:Krt82	UTSW	15	101545099	missense	possibly damaging	0.85
R5212:Krt82	UTSW	15	101545049	missense	probably damaging	1.00
R5260:Krt82	UTSW	15	101548388	missense	possibly damaging	0.88
R5821:Krt82	UTSW	15	101548385	nonsense	probably null
R6009:Krt82	UTSW	15	101545105	missense	probably benign	0.00
R6955:Krt82	UTSW	15	101542849	missense	probably damaging	1.00
R7194:Krt82	UTSW	15	101542756	missense	probably damaging	1.00
R7307:Krt82	UTSW	15	101542907	missense	probably damaging	0.97
R7420:Krt82	UTSW	15	101545587	missense	probably damaging	0.96
R7837:Krt82	UTSW	15	101548357	missense	possibly damaging	0.86
R8354:Krt82	UTSW	15	101541803	missense	probably damaging	1.00
R8371:Krt82	UTSW	15	101545111	missense	probably benign	0.12
R8454:Krt82	UTSW	15	101541803	missense	probably damaging	1.00
Z1176:Krt82	UTSW	15	101541852	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TAAGAGGCCGATGGACAAATGCCC -3'
(R):5'- GTCACCCACTATGAAGTGAGCAAGG -3'

Sequencing Primer
(F):5'- ATGGACAAATGCCCCTTCCTG -3'
(R):5'- TCTCGGAGCCTGTGCAAC -3'

Posted On

2013-11-18