Incidental Mutation 'R1073:Krt82'
ID85548
Institutional Source Beutler Lab
Gene Symbol Krt82
Ensembl Gene ENSMUSG00000049548
Gene Namekeratin 82
SynonymsKrt2-20
MMRRC Submission 039159-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R1073 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101541214-101550667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101550254 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 117 (D117V)
Ref Sequence ENSEMBL: ENSMUSP00000023713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023713] [ENSMUST00000023714]
Predicted Effect probably damaging
Transcript: ENSMUST00000023713
AA Change: D117V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023713
Gene: ENSMUSG00000049548
AA Change: D117V

DomainStartEndE-ValueType
low complexity region 38 57 N/A INTRINSIC
Pfam:Keratin_2_head 61 114 6.1e-13 PFAM
Filament 117 428 1.32e-153 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000023714
SMART Domains Protein: ENSMUSP00000023714
Gene: ENSMUSG00000048699

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 139 3.1e-24 PFAM
Filament 142 453 1.05e-179 SMART
low complexity region 465 522 N/A INTRINSIC
low complexity region 527 535 N/A INTRINSIC
Meta Mutation Damage Score 0.0831 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this keratin appears to be a hair cuticle-specific keratin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 T C 4: 136,236,431 I334T probably damaging Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Cacna2d3 T A 14: 29,045,623 H765L probably damaging Het
Cngb1 A G 8: 95,303,567 probably null Het
Csmd1 C T 8: 16,358,463 probably benign Het
Cux1 A T 5: 136,252,541 probably null Het
D7Ertd443e T C 7: 134,270,218 K232R probably damaging Het
Dock6 A G 9: 21,846,518 S97P probably benign Het
Eml5 G A 12: 98,830,973 A1099V probably damaging Het
Gtf2h1 G A 7: 46,816,944 A472T probably damaging Het
Lrfn5 A G 12: 61,840,809 Y461C probably damaging Het
Mkl2 T A 16: 13,412,318 S956T possibly damaging Het
Mmrn2 G A 14: 34,396,294 probably null Het
Msrb3 T A 10: 120,784,136 S93C possibly damaging Het
Ncl AAAGCCTCCC AAAGCCTCCCAAGCCTCCC 1: 86,350,816 probably benign Het
Olfr228 A G 2: 86,483,640 I34T probably damaging Het
Osbpl10 C T 9: 115,207,553 Q381* probably null Het
Pelp1 A G 11: 70,396,590 L464P probably damaging Het
Pigs A G 11: 78,335,605 D216G probably benign Het
Ptprk T C 10: 28,496,947 probably null Het
Pyroxd1 T C 6: 142,348,644 probably null Het
Ros1 T A 10: 52,046,125 D2284V probably damaging Het
Rptor T C 11: 119,743,891 S178P possibly damaging Het
Slc8a1 C T 17: 81,648,407 D401N probably damaging Het
Tas2r143 T C 6: 42,400,760 Y175H probably benign Het
Tdrd9 T C 12: 112,023,259 S502P probably damaging Het
Tmem38a A G 8: 72,580,103 H142R probably damaging Het
Tmem44 A G 16: 30,514,833 probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Umod A G 7: 119,464,741 V614A possibly damaging Het
Vmn2r5 A T 3: 64,491,305 L751* probably null Het
Wdr37 A T 13: 8,805,840 I489N probably damaging Het
Xdh T C 17: 73,939,836 T78A probably benign Het
Zfp866 A T 8: 69,767,622 probably benign Het
Other mutations in Krt82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Krt82 APN 15 101543378 missense probably damaging 0.97
IGL01112:Krt82 APN 15 101545523 missense probably damaging 1.00
IGL01820:Krt82 APN 15 101543452 splice site probably benign
IGL02529:Krt82 APN 15 101550396 nonsense probably null
IGL02894:Krt82 APN 15 101542720 missense probably damaging 1.00
IGL02974:Krt82 APN 15 101550585 nonsense probably null
IGL03263:Krt82 APN 15 101541872 missense probably benign 0.00
R0268:Krt82 UTSW 15 101541713 missense probably benign 0.02
R0385:Krt82 UTSW 15 101545593 missense probably damaging 1.00
R0542:Krt82 UTSW 15 101545600 splice site probably benign
R1601:Krt82 UTSW 15 101545153 missense probably damaging 1.00
R1795:Krt82 UTSW 15 101543384 missense possibly damaging 0.90
R1944:Krt82 UTSW 15 101548535 missense probably damaging 1.00
R1974:Krt82 UTSW 15 101545162 missense probably benign 0.00
R2049:Krt82 UTSW 15 101545156 missense probably damaging 0.96
R2140:Krt82 UTSW 15 101545156 missense probably damaging 0.96
R2851:Krt82 UTSW 15 101548435 missense probably damaging 1.00
R2852:Krt82 UTSW 15 101548435 missense probably damaging 1.00
R2853:Krt82 UTSW 15 101548435 missense probably damaging 1.00
R3815:Krt82 UTSW 15 101550600 missense probably damaging 1.00
R4324:Krt82 UTSW 15 101541747 missense probably benign 0.00
R4798:Krt82 UTSW 15 101550488 missense probably benign 0.01
R4980:Krt82 UTSW 15 101545099 missense possibly damaging 0.85
R5212:Krt82 UTSW 15 101545049 missense probably damaging 1.00
R5260:Krt82 UTSW 15 101548388 missense possibly damaging 0.88
R5821:Krt82 UTSW 15 101548385 nonsense probably null
R6009:Krt82 UTSW 15 101545105 missense probably benign 0.00
R6955:Krt82 UTSW 15 101542849 missense probably damaging 1.00
R7194:Krt82 UTSW 15 101542756 missense probably damaging 1.00
R7307:Krt82 UTSW 15 101542907 missense probably damaging 0.97
R7420:Krt82 UTSW 15 101545587 missense probably damaging 0.96
R7837:Krt82 UTSW 15 101548357 missense possibly damaging 0.86
R8354:Krt82 UTSW 15 101541803 missense probably damaging 1.00
R8371:Krt82 UTSW 15 101545111 missense probably benign 0.12
R8454:Krt82 UTSW 15 101541803 missense probably damaging 1.00
Z1176:Krt82 UTSW 15 101541852 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAGAGGCCGATGGACAAATGCCC -3'
(R):5'- GTCACCCACTATGAAGTGAGCAAGG -3'

Sequencing Primer
(F):5'- ATGGACAAATGCCCCTTCCTG -3'
(R):5'- TCTCGGAGCCTGTGCAAC -3'
Posted On2013-11-18