Incidental Mutation 'R1073:Mkl2'
ID85550
Institutional Source Beutler Lab
Gene Symbol Mkl2
Ensembl Gene ENSMUSG00000009569
Gene NameMKL/myocardin-like 2
SynonymsGt4-1, MRTF-B, Mrtfb
MMRRC Submission 039159-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1073 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location13256481-13417529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13412318 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 956 (S956T)
Ref Sequence ENSEMBL: ENSMUSP00000122815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009713] [ENSMUST00000149359]
Predicted Effect probably benign
Transcript: ENSMUST00000009713
AA Change: S967T

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000009713
Gene: ENSMUSG00000009569
AA Change: S967T

DomainStartEndE-ValueType
RPEL 51 76 9.67e-5 SMART
RPEL 95 120 2.22e-4 SMART
RPEL 139 164 1.56e-8 SMART
low complexity region 217 230 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 329 352 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
SAP 394 428 1.29e-8 SMART
low complexity region 495 510 N/A INTRINSIC
coiled coil region 552 601 N/A INTRINSIC
low complexity region 603 617 N/A INTRINSIC
low complexity region 699 722 N/A INTRINSIC
low complexity region 749 775 N/A INTRINSIC
low complexity region 842 854 N/A INTRINSIC
low complexity region 1039 1050 N/A INTRINSIC
low complexity region 1057 1074 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140892
Predicted Effect possibly damaging
Transcript: ENSMUST00000149359
AA Change: S956T

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122815
Gene: ENSMUSG00000009569
AA Change: S956T

DomainStartEndE-ValueType
RPEL 40 65 4.51e-5 SMART
RPEL 84 109 2.22e-4 SMART
RPEL 128 153 1.56e-8 SMART
low complexity region 206 219 N/A INTRINSIC
low complexity region 280 293 N/A INTRINSIC
low complexity region 318 341 N/A INTRINSIC
low complexity region 358 370 N/A INTRINSIC
SAP 383 417 1.29e-8 SMART
low complexity region 484 499 N/A INTRINSIC
coiled coil region 541 590 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
low complexity region 688 711 N/A INTRINSIC
low complexity region 738 764 N/A INTRINSIC
low complexity region 831 843 N/A INTRINSIC
low complexity region 1028 1039 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210378
Meta Mutation Damage Score 0.0833 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.5%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Mice homozygous for knock-out alleles exhibit prenatal lethality with widespread hemorrhaging, cardiovascular defects, and craniofacial anomalies. Mice homozygous for a gene trap allele exhibit fetal lethality due to cardiac outflow tractdefects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 T C 4: 136,236,431 I334T probably damaging Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Cacna2d3 T A 14: 29,045,623 H765L probably damaging Het
Cngb1 A G 8: 95,303,567 probably null Het
Csmd1 C T 8: 16,358,463 probably benign Het
Cux1 A T 5: 136,252,541 probably null Het
D7Ertd443e T C 7: 134,270,218 K232R probably damaging Het
Dock6 A G 9: 21,846,518 S97P probably benign Het
Eml5 G A 12: 98,830,973 A1099V probably damaging Het
Gtf2h1 G A 7: 46,816,944 A472T probably damaging Het
Krt82 T A 15: 101,550,254 D117V probably damaging Het
Lrfn5 A G 12: 61,840,809 Y461C probably damaging Het
Mmrn2 G A 14: 34,396,294 probably null Het
Msrb3 T A 10: 120,784,136 S93C possibly damaging Het
Ncl AAAGCCTCCC AAAGCCTCCCAAGCCTCCC 1: 86,350,816 probably benign Het
Olfr228 A G 2: 86,483,640 I34T probably damaging Het
Osbpl10 C T 9: 115,207,553 Q381* probably null Het
Pelp1 A G 11: 70,396,590 L464P probably damaging Het
Pigs A G 11: 78,335,605 D216G probably benign Het
Ptprk T C 10: 28,496,947 probably null Het
Pyroxd1 T C 6: 142,348,644 probably null Het
Ros1 T A 10: 52,046,125 D2284V probably damaging Het
Rptor T C 11: 119,743,891 S178P possibly damaging Het
Slc8a1 C T 17: 81,648,407 D401N probably damaging Het
Tas2r143 T C 6: 42,400,760 Y175H probably benign Het
Tdrd9 T C 12: 112,023,259 S502P probably damaging Het
Tmem38a A G 8: 72,580,103 H142R probably damaging Het
Tmem44 A G 16: 30,514,833 probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Umod A G 7: 119,464,741 V614A possibly damaging Het
Vmn2r5 A T 3: 64,491,305 L751* probably null Het
Wdr37 A T 13: 8,805,840 I489N probably damaging Het
Xdh T C 17: 73,939,836 T78A probably benign Het
Zfp866 A T 8: 69,767,622 probably benign Het
Other mutations in Mkl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Mkl2 APN 16 13403222 missense probably benign 0.28
IGL00546:Mkl2 APN 16 13403225 missense possibly damaging 0.71
IGL01325:Mkl2 APN 16 13401224 missense probably damaging 1.00
IGL02125:Mkl2 APN 16 13400183 splice site probably null
IGL02803:Mkl2 APN 16 13403156 missense possibly damaging 0.94
IGL03143:Mkl2 APN 16 13400812 missense possibly damaging 0.46
IGL03180:Mkl2 APN 16 13398332 missense probably damaging 1.00
R0281:Mkl2 UTSW 16 13412163 missense probably damaging 0.99
R0505:Mkl2 UTSW 16 13412526 missense possibly damaging 0.80
R0540:Mkl2 UTSW 16 13381601 missense probably damaging 1.00
R0607:Mkl2 UTSW 16 13381601 missense probably damaging 1.00
R1423:Mkl2 UTSW 16 13412241 missense possibly damaging 0.96
R1432:Mkl2 UTSW 16 13401002 missense probably benign 0.01
R1459:Mkl2 UTSW 16 13401569 missense possibly damaging 0.93
R1693:Mkl2 UTSW 16 13398470 missense possibly damaging 0.67
R1693:Mkl2 UTSW 16 13398471 missense probably damaging 0.99
R2006:Mkl2 UTSW 16 13381576 nonsense probably null
R2076:Mkl2 UTSW 16 13401382 missense probably benign 0.01
R2125:Mkl2 UTSW 16 13400804 missense possibly damaging 0.94
R2145:Mkl2 UTSW 16 13412586 missense probably damaging 0.98
R3722:Mkl2 UTSW 16 13385693 missense probably damaging 1.00
R3883:Mkl2 UTSW 16 13401458 missense probably damaging 0.99
R4088:Mkl2 UTSW 16 13384200 missense probably damaging 0.98
R4204:Mkl2 UTSW 16 13403255 missense possibly damaging 0.88
R4301:Mkl2 UTSW 16 13398305 missense probably damaging 1.00
R4622:Mkl2 UTSW 16 13332706 missense probably damaging 1.00
R4633:Mkl2 UTSW 16 13379873 missense possibly damaging 0.95
R4765:Mkl2 UTSW 16 13412594 missense probably damaging 1.00
R5201:Mkl2 UTSW 16 13401592 missense probably benign 0.00
R5403:Mkl2 UTSW 16 13401013 missense probably damaging 0.97
R5725:Mkl2 UTSW 16 13384310 nonsense probably null
R6511:Mkl2 UTSW 16 13379850 missense probably damaging 1.00
R7207:Mkl2 UTSW 16 13326436 missense probably benign
R7269:Mkl2 UTSW 16 13401034 missense possibly damaging 0.48
R7311:Mkl2 UTSW 16 13405854 nonsense probably null
R7460:Mkl2 UTSW 16 13400976 missense probably benign 0.00
Z1177:Mkl2 UTSW 16 13385606 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGTGACTTCAGCCTTGCGTTATTG -3'
(R):5'- GTCTAGCCACTCCATGTTGTCCAG -3'

Sequencing Primer
(F):5'- GCTCTCTCTGCCTCTAAGATGTAAG -3'
(R):5'- CCAGGTTGGAGTCTGACAG -3'
Posted On2013-11-18