Incidental Mutation 'R1076:Larp4'
ID85668
Institutional Source Beutler Lab
Gene Symbol Larp4
Ensembl Gene ENSMUSG00000023025
Gene NameLa ribonucleoprotein domain family, member 4
Synonyms
MMRRC Submission 039162-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R1076 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99970065-100016358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99997430 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 295 (T295A)
Ref Sequence ENSEMBL: ENSMUSP00000155661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057632] [ENSMUST00000100206] [ENSMUST00000230521] [ENSMUST00000230956] [ENSMUST00000231160]
Predicted Effect probably benign
Transcript: ENSMUST00000057632
AA Change: T353A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086964
Gene: ENSMUSG00000023025
AA Change: T353A

DomainStartEndE-ValueType
LA 112 190 2.44e-40 SMART
RRM 195 265 3.28e-2 SMART
low complexity region 375 388 N/A INTRINSIC
low complexity region 433 453 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100206
AA Change: T354A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097780
Gene: ENSMUSG00000023025
AA Change: T354A

DomainStartEndE-ValueType
LA 113 191 2.44e-40 SMART
RRM 196 266 3.28e-2 SMART
low complexity region 376 389 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 458 471 N/A INTRINSIC
low complexity region 652 664 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229891
Predicted Effect probably benign
Transcript: ENSMUST00000230521
Predicted Effect probably benign
Transcript: ENSMUST00000230956
AA Change: T355A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000231160
AA Change: T295A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ang4 T C 14: 51,764,302 K63R probably damaging Het
Ankrd50 T C 3: 38,454,922 N176D probably damaging Het
Apbb1 A T 7: 105,573,855 L183Q probably benign Het
BC049730 A G 7: 24,713,742 K162R probably benign Het
Cdh17 T C 4: 11,795,581 V387A probably benign Het
Cldn4 A G 5: 134,946,337 S137P probably damaging Het
Cnn1 A T 9: 22,107,869 Q157L probably damaging Het
Csn1s1 A T 5: 87,676,383 probably null Het
Dennd3 C T 15: 73,540,733 H415Y probably damaging Het
Dnpep A G 1: 75,315,938 probably benign Het
Dram1 C A 10: 88,325,384 V208L probably damaging Het
Elovl2 A G 13: 41,190,107 V115A possibly damaging Het
Fryl C T 5: 73,124,673 probably benign Het
Gsap A G 5: 21,287,694 T707A possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ktn1 T A 14: 47,694,638 M674K probably damaging Het
Lrp1 T C 10: 127,563,797 probably benign Het
Macf1 T C 4: 123,385,598 D3870G probably damaging Het
Mctp2 T G 7: 72,185,867 probably null Het
Nbn A T 4: 15,970,719 probably null Het
Neb A G 2: 52,204,892 Y4883H probably damaging Het
Nsun6 A T 2: 15,009,472 C286S probably benign Het
Pabpc4 T A 4: 123,292,908 D307E possibly damaging Het
Pik3cg G A 12: 32,195,714 probably benign Het
Ptpdc1 C T 13: 48,586,810 E382K probably damaging Het
Serpina3k A G 12: 104,340,994 T162A probably benign Het
Sis T C 3: 72,934,098 T795A probably damaging Het
Skint8 T A 4: 111,927,219 V14E probably damaging Het
Slc2a1 T G 4: 119,134,448 M351R probably damaging Het
Slc41a3 G A 6: 90,644,160 C394Y probably benign Het
Srp54b T C 12: 55,255,528 probably benign Het
Ulk2 G A 11: 61,819,309 H358Y probably damaging Het
Utp20 A G 10: 88,772,459 M1572T probably benign Het
Utp20 A T 10: 88,772,543 I1544N possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Other mutations in Larp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Larp4 APN 15 99987421 missense probably damaging 0.98
IGL01668:Larp4 APN 15 99987474 missense probably damaging 1.00
IGL01687:Larp4 APN 15 99996488 missense probably damaging 1.00
IGL02105:Larp4 APN 15 99986071 missense probably damaging 1.00
IGL02676:Larp4 APN 15 99990421 missense possibly damaging 0.94
IGL03286:Larp4 APN 15 99986086 missense probably damaging 1.00
Skewer UTSW 15 100007730 critical splice donor site probably null
R1996:Larp4 UTSW 15 99984963 missense probably damaging 1.00
R2183:Larp4 UTSW 15 100011897 missense probably benign 0.16
R2260:Larp4 UTSW 15 99997396 missense possibly damaging 0.95
R3777:Larp4 UTSW 15 99990357 missense probably damaging 1.00
R3916:Larp4 UTSW 15 99990403 missense probably benign 0.00
R3962:Larp4 UTSW 15 100012145 missense probably damaging 1.00
R5059:Larp4 UTSW 15 100005290 missense probably damaging 1.00
R5081:Larp4 UTSW 15 99973017 intron probably benign
R5104:Larp4 UTSW 15 99986083 missense probably damaging 1.00
R5409:Larp4 UTSW 15 99986064 missense probably damaging 0.98
R5436:Larp4 UTSW 15 99986114 missense probably damaging 0.98
R6895:Larp4 UTSW 15 100007730 critical splice donor site probably null
R7316:Larp4 UTSW 15 100001017 missense probably benign
R7483:Larp4 UTSW 15 99991778 missense probably benign 0.01
R7510:Larp4 UTSW 15 99993377 missense probably benign 0.07
R8131:Larp4 UTSW 15 99994689 missense probably damaging 0.99
R8263:Larp4 UTSW 15 99986080 missense probably benign 0.00
R8322:Larp4 UTSW 15 100010356 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGCATTGCAGAAGTGTGTGAGAG -3'
(R):5'- AACTGgggggtagagagatggc -3'

Sequencing Primer
(F):5'- GCTCCCTTTCCCAATGGTAGTTT -3'
(R):5'- agagagagagagaaggcaaaac -3'
Posted On2013-11-18