Incidental Mutation 'R1124:Gm8298'
ID95937
Institutional Source Beutler Lab
Gene Symbol Gm8298
Ensembl Gene ENSMUSG00000095522
Gene Namepredicted gene 8298
Synonyms
MMRRC Submission 039197-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R1124 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location59861051-59877313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59865218 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 48 (T48A)
Ref Sequence ENSEMBL: ENSMUSP00000137307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179799]
Predicted Effect probably benign
Transcript: ENSMUST00000179799
AA Change: T48A

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137307
Gene: ENSMUSG00000095522
AA Change: T48A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:COesterase 91 217 9.6e-7 PFAM
Pfam:Abhydrolase_3 107 279 1.1e-36 PFAM
Pfam:Abhydrolase_3 284 375 1.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194941
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,662,082 R642Q possibly damaging Het
9430007A20Rik A G 4: 144,528,624 T205A probably benign Het
Anxa10 C T 8: 62,061,004 probably null Het
Bcl11a A T 11: 24,163,928 M424L probably damaging Het
Bhlhe41 A G 6: 145,863,730 S119P probably damaging Het
C2cd3 A G 7: 100,422,681 D1033G probably benign Het
Ccdc174 T C 6: 91,899,580 V466A probably benign Het
Drd2 T C 9: 49,395,640 Y9H probably damaging Het
Fbxw14 T A 9: 109,276,168 I310F possibly damaging Het
Gm436 T C 4: 144,670,275 S296G probably benign Het
Grm3 C T 5: 9,570,297 V316I probably benign Het
Gys2 A G 6: 142,446,013 Y508H probably damaging Het
Lrp1b T A 2: 40,875,051 D2921V probably damaging Het
Lrrc6 T A 15: 66,438,415 T335S possibly damaging Het
Macrod2 A G 2: 140,452,627 K71R probably damaging Het
Myh7 A T 14: 54,973,870 V1614E possibly damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr1056 T A 2: 86,355,895 K162N probably damaging Het
Pirb T A 7: 3,719,732 N87I probably benign Het
Pmfbp1 A G 8: 109,530,483 probably null Het
Rasa4 A G 5: 136,105,656 N627S probably benign Het
Spata31d1b A C 13: 59,716,654 M539L probably benign Het
Tbc1d23 A T 16: 57,214,162 probably null Het
Tnfrsf1b A T 4: 145,224,356 L229Q probably benign Het
Trip12 A T 1: 84,737,037 V443E probably damaging Het
Ush2a G T 1: 188,753,536 V2948L probably damaging Het
Vmn1r204 A T 13: 22,557,039 Y280F possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r93 G T 17: 18,298,448 K56N probably benign Het
Xrn1 A G 9: 96,003,865 I880V probably benign Het
Zfp106 C T 2: 120,534,714 G404E probably benign Het
Other mutations in Gm8298
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Gm8298 APN 3 59868900 missense possibly damaging 0.80
IGL02064:Gm8298 APN 3 59877042 missense probably damaging 1.00
IGL02317:Gm8298 APN 3 59876987 missense probably benign 0.00
R0270:Gm8298 UTSW 3 59877019 missense probably benign
R0580:Gm8298 UTSW 3 59877049 missense probably damaging 1.00
R1208:Gm8298 UTSW 3 59865294 missense probably benign 0.27
R1222:Gm8298 UTSW 3 59877261 nonsense probably null
R1436:Gm8298 UTSW 3 59865339 missense probably damaging 0.98
R1529:Gm8298 UTSW 3 59861112 missense probably benign
R1806:Gm8298 UTSW 3 59877150 missense probably damaging 1.00
R2130:Gm8298 UTSW 3 59865348 missense probably damaging 1.00
R4209:Gm8298 UTSW 3 59877156 missense probably damaging 1.00
R4597:Gm8298 UTSW 3 59876793 missense possibly damaging 0.47
R4910:Gm8298 UTSW 3 59869014 critical splice donor site probably null
R5571:Gm8298 UTSW 3 59877219 missense probably damaging 1.00
R6131:Gm8298 UTSW 3 59868903 missense possibly damaging 0.76
R6447:Gm8298 UTSW 3 59865398 missense probably damaging 0.99
R6481:Gm8298 UTSW 3 59861057 missense probably benign 0.00
R6795:Gm8298 UTSW 3 59868936 missense probably damaging 1.00
R7092:Gm8298 UTSW 3 59861079 missense probably benign 0.41
R7334:Gm8298 UTSW 3 59868959 missense probably damaging 1.00
R7602:Gm8298 UTSW 3 59877276 missense probably benign 0.17
R7660:Gm8298 UTSW 3 59865268 missense probably benign 0.05
R7705:Gm8298 UTSW 3 59876747 missense probably benign 0.25
R7708:Gm8298 UTSW 3 59865335 missense probably benign 0.00
R8167:Gm8298 UTSW 3 59877211 missense probably benign 0.03
X0011:Gm8298 UTSW 3 59861177 missense probably benign
X0022:Gm8298 UTSW 3 59877024 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCTTTGCTATATACACTACCgtggg -3'
(R):5'- CTTTTGGGTAAATACAGACGAACAGGGA -3'

Sequencing Primer
(F):5'- cttggaacaaaaggctcagac -3'
(R):5'- GATGTCACTGAAGTCTGTGTCAATC -3'
Posted On2014-01-05