Incidental Mutation 'R1438:Smo'
ID160762
Institutional Source Beutler Lab
Gene Symbol Smo
Ensembl Gene ENSMUSG00000001761
Gene Namesmoothened, frizzled class receptor
SynonymsE130215L21Rik
MMRRC Submission 039493-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1438 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location29735503-29761365 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29755483 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 385 (V385I)
Ref Sequence ENSEMBL: ENSMUSP00000001812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001812]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001812
AA Change: V385I

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001812
Gene: ENSMUSG00000001761
AA Change: V385I

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
FRI 73 187 5.48e-49 SMART
Frizzled 224 559 2.82e-148 SMART
low complexity region 641 652 N/A INTRINSIC
low complexity region 671 684 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119868
Meta Mutation Damage Score 0.1072 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor that interacts with the patched protein, a receptor for hedgehog proteins. The encoded protein tranduces signals to other proteins after activation by a hedgehog protein/patched protein complex. [provided by RefSeq, Jul 2010]
PHENOTYPE: Both an ENU-induced mutation and a null mutation are midgestation lethal. Observed defects include failure of neural tube closure and heart and gut defects. Conditional knockouts in chondrocytes and dental epithelium result in short long bones and dentalepithelium derivative defects, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A T 5: 137,554,609 I67F probably damaging Het
Adam24 A T 8: 40,681,392 N633I probably benign Het
Adgrg6 T C 10: 14,468,841 S123G possibly damaging Het
Afdn T A 17: 13,855,390 F940L probably damaging Het
Ahrr A T 13: 74,224,868 Y26* probably null Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Aox3 A T 1: 58,153,178 T536S probably benign Het
AU019823 C A 9: 50,607,672 K213N possibly damaging Het
Boc A T 16: 44,488,746 probably null Het
Cchcr1 T C 17: 35,530,560 probably null Het
Cct2 A T 10: 117,054,992 probably benign Het
Cd84 A T 1: 171,852,118 Y121F probably damaging Het
Cecr2 T A 6: 120,761,472 C275* probably null Het
Chchd3 C A 6: 33,008,568 probably benign Het
Ckmt2 A T 13: 91,859,852 probably benign Het
Col5a3 T C 9: 20,779,957 K1131E probably damaging Het
Dek A T 13: 47,088,171 S306T probably benign Het
Dhx32 T C 7: 133,737,340 E322G possibly damaging Het
Dlg5 T A 14: 24,154,605 D941V possibly damaging Het
Dnah10 A G 5: 124,798,945 N2559S probably benign Het
Dnajc3 A G 14: 118,968,106 T171A probably benign Het
Eftud2 G T 11: 102,860,042 F308L probably damaging Het
Elp6 T C 9: 110,314,055 F95S probably damaging Het
Emsy C T 7: 98,621,406 V450I possibly damaging Het
Exoc3 A T 13: 74,190,179 M362K probably damaging Het
Fat2 A T 11: 55,287,811 D1474E probably damaging Het
Fcgbp T A 7: 28,103,733 C1587* probably null Het
Fosl2 T A 5: 32,146,985 L88Q probably damaging Het
Fsd2 T C 7: 81,548,873 D381G probably benign Het
Golim4 A C 3: 75,956,133 S56A probably damaging Het
Gpr39 T C 1: 125,872,356 probably benign Het
Gucy1b2 T C 14: 62,414,321 I409V probably damaging Het
Hivep1 A G 13: 42,158,120 T1279A probably benign Het
Ifit1bl2 T A 19: 34,619,169 Q349L possibly damaging Het
Kcnc1 A T 7: 46,428,267 I498F possibly damaging Het
Kctd21 T A 7: 97,347,497 I59N probably damaging Het
Lama5 T A 2: 180,182,800 T2577S probably benign Het
Mief2 G T 11: 60,730,314 R9M possibly damaging Het
Mmp3 T C 9: 7,453,705 V442A probably benign Het
Nrxn3 C T 12: 90,332,135 R477W probably damaging Het
Olfr1126 A G 2: 87,457,992 T276A probably benign Het
Olfr57 T A 10: 79,035,288 V164E possibly damaging Het
Parp1 A G 1: 180,591,242 T656A probably benign Het
Pcdhb19 A G 18: 37,497,962 D270G probably damaging Het
Phlpp1 A G 1: 106,173,412 D470G possibly damaging Het
Prdm1 T C 10: 44,442,128 E248G probably benign Het
Prtg C T 9: 72,910,750 probably benign Het
Ptpn1 T C 2: 167,976,609 Y424H probably damaging Het
Ptprr T C 10: 116,256,204 V369A probably damaging Het
Rai1 T G 11: 60,185,395 V95G probably benign Het
Rasal3 T A 17: 32,393,535 probably null Het
Rbm19 A G 5: 120,122,896 E195G probably benign Het
Rhbdd3 T A 11: 5,103,332 L44Q probably damaging Het
Ripply2 T C 9: 87,019,660 W80R probably damaging Het
Rnf183 A G 4: 62,428,523 C13R probably damaging Het
Rorb A G 19: 18,955,053 L367P probably damaging Het
Rpl7a-ps5 C T 17: 57,839,140 probably benign Het
Rreb1 A G 13: 37,930,605 N647D probably benign Het
Rtn1 A T 12: 72,304,413 S341T probably damaging Het
Ryr3 T C 2: 112,757,701 S2632G probably benign Het
Scube1 A G 15: 83,615,026 C633R possibly damaging Het
Sdk1 A T 5: 142,038,323 I723F probably damaging Het
Sec23a A T 12: 59,002,010 C109S probably damaging Het
Sept11 T C 5: 93,148,428 F60L probably damaging Het
Sgf29 G A 7: 126,671,891 probably null Het
Skint5 A G 4: 113,556,111 probably benign Het
Tada2a G A 11: 84,110,011 T76I probably damaging Het
Tas2r118 T A 6: 23,969,423 H213L possibly damaging Het
Thoc5 A T 11: 4,911,427 probably benign Het
Tmem33 T A 5: 67,267,291 probably null Het
Top1mt A G 15: 75,674,398 L78P probably damaging Het
Uvssa T A 5: 33,413,884 probably benign Het
Vmn2r50 A T 7: 10,050,135 C137* probably null Het
Vmn2r81 A G 10: 79,293,857 T861A probably benign Het
Wnt3 A T 11: 103,808,251 N61I probably damaging Het
Zswim9 A G 7: 13,277,218 I68T possibly damaging Het
Zzef1 T C 11: 72,912,945 I2535T probably damaging Het
Other mutations in Smo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Smo APN 6 29758894 nonsense probably null
IGL01969:Smo APN 6 29755172 critical splice acceptor site probably null
IGL02078:Smo APN 6 29754708 missense possibly damaging 0.46
IGL02248:Smo APN 6 29757292 missense possibly damaging 0.69
IGL02496:Smo APN 6 29758481 missense probably damaging 0.99
IGL03159:Smo APN 6 29758505 missense probably benign 0.00
knobby UTSW 6 29736174 missense probably benign
R0548:Smo UTSW 6 29759586 missense possibly damaging 0.45
R0606:Smo UTSW 6 29753604 missense possibly damaging 0.69
R1164:Smo UTSW 6 29754719 missense probably benign 0.18
R1900:Smo UTSW 6 29736056 missense unknown
R2022:Smo UTSW 6 29754716 missense possibly damaging 0.87
R2023:Smo UTSW 6 29754716 missense possibly damaging 0.87
R2129:Smo UTSW 6 29757314 missense probably damaging 1.00
R4033:Smo UTSW 6 29759918 missense probably damaging 0.98
R4795:Smo UTSW 6 29755574 missense probably damaging 0.99
R4878:Smo UTSW 6 29753571 missense probably benign 0.02
R4920:Smo UTSW 6 29759594 missense probably damaging 1.00
R5165:Smo UTSW 6 29736078 missense unknown
R5350:Smo UTSW 6 29754467 missense probably benign 0.02
R5554:Smo UTSW 6 29736124 missense possibly damaging 0.72
R6409:Smo UTSW 6 29736114 missense unknown
R6440:Smo UTSW 6 29756814 missense possibly damaging 0.93
R6707:Smo UTSW 6 29736174 missense probably benign
R6766:Smo UTSW 6 29736045 missense unknown
R7061:Smo UTSW 6 29760230 missense probably damaging 1.00
R7147:Smo UTSW 6 29758449 missense not run
Predicted Primers PCR Primer
(F):5'- CATCTTCACAGCTCCAGTGAGACC -3'
(R):5'- GCTCAGCACACTATGTTACCTGGC -3'

Sequencing Primer
(F):5'- AGTGAGACCCTGTCCTGTG -3'
(R):5'- AGTAGCCTCCCACAATAAGC -3'
Posted On2014-03-14