Incidental Mutation 'R1534:B4galt2'
ID166813
Institutional Source Beutler Lab
Gene Symbol B4galt2
Ensembl Gene ENSMUSG00000028541
Gene NameUDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
Synonyms
MMRRC Submission 039573-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R1534 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location117869260-117883487 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117877472 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 233 (H233R)
Ref Sequence ENSEMBL: ENSMUSP00000102029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030266] [ENSMUST00000084325] [ENSMUST00000106421] [ENSMUST00000106422] [ENSMUST00000131938] [ENSMUST00000149168] [ENSMUST00000153358] [ENSMUST00000166325] [ENSMUST00000167443] [ENSMUST00000171052] [ENSMUST00000171548]
Predicted Effect probably damaging
Transcript: ENSMUST00000030266
AA Change: H233R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030266
Gene: ENSMUSG00000028541
AA Change: H233R

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 228 4.2e-59 PFAM
Pfam:Glyco_transf_7C 232 310 2.1e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084325
AA Change: H233R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081352
Gene: ENSMUSG00000028541
AA Change: H233R

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106421
AA Change: H233R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102029
Gene: ENSMUSG00000028541
AA Change: H233R

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106422
SMART Domains Protein: ENSMUSP00000102030
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137016
Predicted Effect probably benign
Transcript: ENSMUST00000149168
SMART Domains Protein: ENSMUSP00000129359
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
low complexity region 91 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153358
SMART Domains Protein: ENSMUSP00000120571
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 197 9.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166325
SMART Domains Protein: ENSMUSP00000131493
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
coiled coil region 33 57 N/A INTRINSIC
low complexity region 61 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167443
SMART Domains Protein: ENSMUSP00000128771
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 188 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170733
Predicted Effect probably benign
Transcript: ENSMUST00000171052
SMART Domains Protein: ENSMUSP00000129502
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
Pfam:CCDC24 21 201 3.9e-67 PFAM
low complexity region 282 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171548
SMART Domains Protein: ENSMUSP00000126539
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Meta Mutation Damage Score 0.438 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene synthesizes N-acetyllactosamine in glycolipids and glycoproteins. Its substrate specificity is affected by alpha-lactalbumin but it is not expressed in lactating mammary tissue. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased brain weight, ectopic Purkinje cells in the cerebellum, and impaired spatial learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,530,429 noncoding transcript Het
Adcy10 T C 1: 165,518,312 I310T probably damaging Het
Adcy5 T C 16: 35,253,259 V469A possibly damaging Het
Agrn C T 4: 156,176,684 C652Y probably damaging Het
Ankfn1 C T 11: 89,523,151 V133M probably damaging Het
Ankrd13c A G 3: 158,001,120 T448A probably benign Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bpifb5 T G 2: 154,229,499 Y249D possibly damaging Het
Brd1 T C 15: 88,689,663 I1078V possibly damaging Het
Celsr3 A G 9: 108,848,884 E3104G probably damaging Het
Cyp2c69 T A 19: 39,851,149 K343N probably benign Het
Cyp4f18 T A 8: 71,992,955 D331V probably damaging Het
D130040H23Rik T C 8: 69,302,726 V261A possibly damaging Het
Dchs1 T C 7: 105,772,040 D391G probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Fat4 T C 3: 38,890,089 F1044L probably damaging Het
Frrs1 A T 3: 116,878,408 T52S probably benign Het
Gan G A 8: 117,187,429 V189I probably benign Het
Hnf1b A G 11: 83,893,583 probably benign Het
Itgae T C 11: 73,145,605 I1123T possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lrrc18 A G 14: 33,008,521 K6E possibly damaging Het
Map2 G A 1: 66,413,180 V492I probably benign Het
Mtr A T 13: 12,235,544 probably benign Het
Ncor1 G T 11: 62,378,504 A689E possibly damaging Het
Olfr153 T A 2: 87,532,672 V213D probably damaging Het
Olfr668 G A 7: 104,925,414 L117F possibly damaging Het
Palm T G 10: 79,816,903 V42G probably damaging Het
Pcm1 G A 8: 41,287,701 V995I probably benign Het
Pfkp A G 13: 6,619,538 V215A probably damaging Het
Prkg2 T C 5: 98,994,561 Y238C probably damaging Het
Prr14 C T 7: 127,473,982 A167V probably benign Het
Ptprn A C 1: 75,257,943 probably null Het
Rexo2 A T 9: 48,468,890 I214N probably damaging Het
Rrbp1 A G 2: 143,988,313 S645P probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Satb2 A T 1: 56,948,233 C64* probably null Het
Sez6 A G 11: 77,963,045 Y347C probably damaging Het
Sos2 A G 12: 69,616,955 I585T probably damaging Het
Spg11 G A 2: 122,092,325 T881M probably damaging Het
Tiam1 A T 16: 89,867,508 probably null Het
Tmem136 A G 9: 43,111,628 W126R probably damaging Het
Top1 T C 2: 160,714,232 I537T probably damaging Het
Trappc6a A G 7: 19,514,213 S33G probably benign Het
Tspan11 G C 6: 127,949,805 V239L probably benign Het
Ubr4 T C 4: 139,428,151 V2190A possibly damaging Het
Usp28 A G 9: 48,985,506 D9G possibly damaging Het
Uty A G Y: 1,245,440 V35A probably benign Het
Vmn2r56 A G 7: 12,694,027 S771P probably benign Het
Wars2 C T 3: 99,216,861 A346V probably damaging Het
Zfp142 G T 1: 74,572,088 N849K probably benign Het
Zfp180 A T 7: 24,101,523 N66I probably benign Het
Other mutations in B4galt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:B4galt2 APN 4 117877181 missense probably damaging 0.99
IGL02207:B4galt2 APN 4 117881521 missense probably damaging 1.00
IGL02224:B4galt2 APN 4 117876913 missense probably benign 0.00
IGL02724:B4galt2 APN 4 117876878 critical splice donor site probably null
IGL02949:B4galt2 APN 4 117881405 missense probably benign 0.05
R1164:B4galt2 UTSW 4 117876944 missense possibly damaging 0.96
R4715:B4galt2 UTSW 4 117877179 missense possibly damaging 0.92
R5640:B4galt2 UTSW 4 117873998 missense probably benign
R6492:B4galt2 UTSW 4 117876967 missense probably damaging 0.99
R6974:B4galt2 UTSW 4 117873951 missense probably damaging 0.98
R7126:B4galt2 UTSW 4 117877538 missense not run
Predicted Primers PCR Primer
(F):5'- TCGTTGGGAAAGCCATTGATCCTC -3'
(R):5'- AGCAAATCTGTGTCCGTCCACC -3'

Sequencing Primer
(F):5'- TTGATCCTCAGAAACTGGGC -3'
(R):5'- GTCCACCCATTCGCCAG -3'
Posted On2014-04-13