Incidental Mutation 'R1534:Olfr668'
ID166823
Institutional Source Beutler Lab
Gene Symbol Olfr668
Ensembl Gene ENSMUSG00000057770
Gene Nameolfactory receptor 668
SynonymsGA_x6K02T2PBJ9-7554614-7553658, MOR34-3
MMRRC Submission 039573-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R1534 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104922291-104928057 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104925414 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 117 (L117F)
Ref Sequence ENSEMBL: ENSMUSP00000150824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164391] [ENSMUST00000215359] [ENSMUST00000217177]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164391
AA Change: L117F

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130975
Gene: ENSMUSG00000057770
AA Change: L117F

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 7.2e-103 PFAM
Pfam:7TM_GPCR_Srsx 37 210 4.7e-10 PFAM
Pfam:7tm_1 43 295 4.6e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215359
AA Change: L117F

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000217177
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,530,429 noncoding transcript Het
Adcy10 T C 1: 165,518,312 I310T probably damaging Het
Adcy5 T C 16: 35,253,259 V469A possibly damaging Het
Agrn C T 4: 156,176,684 C652Y probably damaging Het
Ankfn1 C T 11: 89,523,151 V133M probably damaging Het
Ankrd13c A G 3: 158,001,120 T448A probably benign Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
B4galt2 T C 4: 117,877,472 H233R probably damaging Het
Bpifb5 T G 2: 154,229,499 Y249D possibly damaging Het
Brd1 T C 15: 88,689,663 I1078V possibly damaging Het
Celsr3 A G 9: 108,848,884 E3104G probably damaging Het
Cyp2c69 T A 19: 39,851,149 K343N probably benign Het
Cyp4f18 T A 8: 71,992,955 D331V probably damaging Het
D130040H23Rik T C 8: 69,302,726 V261A possibly damaging Het
Dchs1 T C 7: 105,772,040 D391G probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Fat4 T C 3: 38,890,089 F1044L probably damaging Het
Frrs1 A T 3: 116,878,408 T52S probably benign Het
Gan G A 8: 117,187,429 V189I probably benign Het
Hnf1b A G 11: 83,893,583 probably benign Het
Itgae T C 11: 73,145,605 I1123T possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lrrc18 A G 14: 33,008,521 K6E possibly damaging Het
Map2 G A 1: 66,413,180 V492I probably benign Het
Mtr A T 13: 12,235,544 probably benign Het
Ncor1 G T 11: 62,378,504 A689E possibly damaging Het
Olfr153 T A 2: 87,532,672 V213D probably damaging Het
Palm T G 10: 79,816,903 V42G probably damaging Het
Pcm1 G A 8: 41,287,701 V995I probably benign Het
Pfkp A G 13: 6,619,538 V215A probably damaging Het
Prkg2 T C 5: 98,994,561 Y238C probably damaging Het
Prr14 C T 7: 127,473,982 A167V probably benign Het
Ptprn A C 1: 75,257,943 probably null Het
Rexo2 A T 9: 48,468,890 I214N probably damaging Het
Rrbp1 A G 2: 143,988,313 S645P probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Satb2 A T 1: 56,948,233 C64* probably null Het
Sez6 A G 11: 77,963,045 Y347C probably damaging Het
Sos2 A G 12: 69,616,955 I585T probably damaging Het
Spg11 G A 2: 122,092,325 T881M probably damaging Het
Tiam1 A T 16: 89,867,508 probably null Het
Tmem136 A G 9: 43,111,628 W126R probably damaging Het
Top1 T C 2: 160,714,232 I537T probably damaging Het
Trappc6a A G 7: 19,514,213 S33G probably benign Het
Tspan11 G C 6: 127,949,805 V239L probably benign Het
Ubr4 T C 4: 139,428,151 V2190A possibly damaging Het
Usp28 A G 9: 48,985,506 D9G possibly damaging Het
Uty A G Y: 1,245,440 V35A probably benign Het
Vmn2r56 A G 7: 12,694,027 S771P probably benign Het
Wars2 C T 3: 99,216,861 A346V probably damaging Het
Zfp142 G T 1: 74,572,088 N849K probably benign Het
Zfp180 A T 7: 24,101,523 N66I probably benign Het
Other mutations in Olfr668
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Olfr668 APN 7 104925104 missense probably damaging 1.00
IGL02250:Olfr668 APN 7 104925015 missense probably damaging 1.00
IGL02743:Olfr668 APN 7 104924868 missense probably damaging 0.98
IGL03105:Olfr668 APN 7 104925764 unclassified probably benign
IGL03252:Olfr668 APN 7 104925387 missense probably benign 0.16
IGL03387:Olfr668 APN 7 104925373 missense probably benign 0.01
R2509:Olfr668 UTSW 7 104925687 missense probably benign 0.40
R2510:Olfr668 UTSW 7 104925687 missense probably benign 0.40
R4739:Olfr668 UTSW 7 104924810 missense possibly damaging 0.91
R4995:Olfr668 UTSW 7 104925735 missense probably benign 0.01
R5071:Olfr668 UTSW 7 104925493 missense probably benign
R5074:Olfr668 UTSW 7 104925493 missense probably benign
R5208:Olfr668 UTSW 7 104925726 missense probably benign
R5293:Olfr668 UTSW 7 104925279 missense probably benign 0.00
R6060:Olfr668 UTSW 7 104925392 missense probably benign 0.28
R6061:Olfr668 UTSW 7 104925392 missense probably benign 0.28
R6063:Olfr668 UTSW 7 104925392 missense probably benign 0.28
R6064:Olfr668 UTSW 7 104925392 missense probably benign 0.28
R6172:Olfr668 UTSW 7 104925296 missense probably benign 0.40
R6492:Olfr668 UTSW 7 104925645 missense possibly damaging 0.60
R6933:Olfr668 UTSW 7 104925123 missense probably benign 0.21
R7040:Olfr668 UTSW 7 104925510 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCTTGGCATTGCCACAGGATAC -3'
(R):5'- GATGCACATGTCTGGATCTCTCTGC -3'

Sequencing Primer
(F):5'- ATTGCCACAGGATACCTTGG -3'
(R):5'- CATGAGGAGGCTCTGCAC -3'
Posted On2014-04-13