Incidental Mutation 'R1503:Dnah12'
ID169480
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Namedynein, axonemal, heavy chain 12
SynonymsDHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12
MMRRC Submission 039553-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.532) question?
Stock #R1503 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location26693274-26891703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26773692 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1426 (S1426P)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433] [ENSMUST00000073309]
Predicted Effect probably damaging
Transcript: ENSMUST00000022433
AA Change: S1426P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: S1426P

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000073309
AA Change: S177P

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073035
Gene: ENSMUSG00000021879
AA Change: S177P

DomainStartEndE-ValueType
Pfam:AAA_6 1 203 4e-84 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Atf7ip G T 6: 136,606,867 V1299L probably damaging Het
Atp12a A T 14: 56,373,424 N342Y probably damaging Het
Atp8b5 G A 4: 43,344,430 G439D probably damaging Het
Bpifb2 G A 2: 153,889,510 D269N possibly damaging Het
Btd T G 14: 31,667,655 C444W probably damaging Het
Cacna1a A G 8: 84,601,946 D1624G probably benign Het
Carmil3 A C 14: 55,498,280 N563T probably damaging Het
Cars T C 7: 143,568,989 R538G probably benign Het
Catsperd A G 17: 56,654,525 K416E possibly damaging Het
Cc2d2a A T 5: 43,695,239 Y386F probably damaging Het
Ccpg1 A G 9: 72,999,478 N66S probably benign Het
Cd48 T A 1: 171,695,847 L86H probably damaging Het
Cdan1 A T 2: 120,729,575 H369Q probably damaging Het
Chil4 T C 3: 106,206,034 D189G probably benign Het
Cit T A 5: 115,873,900 Y189N possibly damaging Het
Cntn3 G A 6: 102,464,565 Q7* probably null Het
Csn1s2a A T 5: 87,775,799 I5F possibly damaging Het
Ctnnd1 C T 2: 84,605,179 probably null Het
Dmxl2 A T 9: 54,446,988 Y391* probably null Het
Dnhd1 T G 7: 105,693,660 S1404A possibly damaging Het
Drosha T A 15: 12,848,073 C484S probably benign Het
Dsg4 A T 18: 20,449,679 I125F probably damaging Het
Egfr T A 11: 16,869,301 M277K possibly damaging Het
Eml5 G T 12: 98,831,174 L1059I probably damaging Het
Erbb4 G T 1: 68,346,546 H295N probably benign Het
Etl4 T G 2: 20,743,874 V139G possibly damaging Het
Fam160a1 T A 3: 85,672,477 Y807F possibly damaging Het
Frem3 A T 8: 80,687,018 E1969D probably damaging Het
Gdf3 T A 6: 122,606,337 D357V probably damaging Het
Gimap8 T A 6: 48,647,529 probably null Het
Gml2 C A 15: 74,821,352 S68* probably null Het
Gphn A G 12: 78,504,629 I248V possibly damaging Het
Greb1 A T 12: 16,724,819 Y192* probably null Het
Hmbs A C 9: 44,337,432 L215W probably benign Het
Iglon5 T A 7: 43,479,025 T123S probably benign Het
Ints2 C T 11: 86,226,781 R705H probably damaging Het
Ints8 A T 4: 11,245,842 L212Q probably damaging Het
Itgad A G 7: 128,198,121 Y846C probably benign Het
Kcnj1 A G 9: 32,396,492 T51A probably damaging Het
Kif1bp A G 10: 62,559,408 V485A probably damaging Het
Kif9 A T 9: 110,510,438 K449N possibly damaging Het
Klk11 G A 7: 43,778,909 W241* probably null Het
Krt32 T C 11: 100,084,110 probably null Het
Loxl1 A G 9: 58,293,640 F513S probably damaging Het
Mapk8ip3 A T 17: 24,904,923 S571T probably damaging Het
Mcam C T 9: 44,141,291 R606C probably damaging Het
Mtss1 T C 15: 58,951,672 N282S probably damaging Het
Myh13 T A 11: 67,353,674 D1012E probably benign Het
Myo16 A G 8: 10,502,817 T952A probably benign Het
Neb T C 2: 52,298,620 D874G probably damaging Het
Nek11 A G 9: 105,163,204 Y553H probably damaging Het
Nr2c2 T A 6: 92,105,331 V9D probably benign Het
Nxf1 T A 19: 8,762,436 F51L probably benign Het
Olfr1260 T C 2: 89,978,528 V250A probably damaging Het
Olfr1347 T C 7: 6,488,179 I232V probably damaging Het
Olfr1350 A G 7: 6,570,471 N160S probably damaging Het
Olfr170 A G 16: 19,606,312 S119P probably benign Het
Olfr344 A T 2: 36,568,873 I92F probably damaging Het
Olfr397 T G 11: 73,964,568 probably null Het
Olfr750 A G 14: 51,070,734 S220P probably damaging Het
Pcdhb8 A T 18: 37,356,519 N76Y probably damaging Het
Pdzrn4 T A 15: 92,399,804 F217I probably damaging Het
Ppp1r16a T A 15: 76,694,399 H434Q probably benign Het
Prpf19 T A 19: 10,901,022 F291I possibly damaging Het
R3hdm2 G T 10: 127,471,826 E319* probably null Het
Sel1l3 A G 5: 53,137,929 Y777H probably damaging Het
Serpinb5 G A 1: 106,870,289 A3T possibly damaging Het
Skp2 C A 15: 9,127,911 V88F probably damaging Het
Slc25a16 T C 10: 62,928,376 Y71H probably damaging Het
Slc6a6 T A 6: 91,740,992 I304N probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sox17 C A 1: 4,491,928 G222C probably damaging Het
Trmu T A 15: 85,895,019 V289E possibly damaging Het
Vdac2 A G 14: 21,837,877 E96G probably damaging Het
Wdhd1 A T 14: 47,247,400 D885E probably benign Het
Zfp646 A G 7: 127,880,136 N495S probably damaging Het
Zfp663 T C 2: 165,352,653 T549A probably damaging Het
Zfp935 G A 13: 62,455,137 A83V possibly damaging Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26771005 missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26710275 splice site probably benign
IGL01681:Dnah12 APN 14 26722160 missense probably benign
IGL02082:Dnah12 APN 14 26707162 missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26716577 missense probably benign 0.20
IGL02170:Dnah12 APN 14 26773112 missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26706917 missense probably benign 0.00
IGL02367:Dnah12 APN 14 26709161 missense probably benign 0.30
IGL02418:Dnah12 APN 14 26773722 missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26724512 missense probably benign 0.02
IGL03066:Dnah12 APN 14 26697398 missense probably benign 0.06
F5770:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26872740 missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26772644 missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26799999 missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26706117 intron probably null
R0364:Dnah12 UTSW 14 26724473 missense probably benign 0.10
R0469:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26709310 missense probably benign 0.00
R0709:Dnah12 UTSW 14 26884265 splice site probably benign
R0734:Dnah12 UTSW 14 26800013 missense probably benign 0.00
R1273:Dnah12 UTSW 14 26739220 nonsense probably null
R1496:Dnah12 UTSW 14 26710248 missense probably benign
R1535:Dnah12 UTSW 14 26816322 missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26766190 missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26778883 missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26766114 missense probably benign 0.02
R1826:Dnah12 UTSW 14 26711019 missense probably benign 0.01
R1829:Dnah12 UTSW 14 26773023 missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26800075 missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26697398 missense probably benign 0.06
R1862:Dnah12 UTSW 14 26709257 missense probably benign 0.30
R1913:Dnah12 UTSW 14 26792264 splice site probably null
R1933:Dnah12 UTSW 14 26734495 missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26814459 missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26781528 missense probably null 1.00
R2113:Dnah12 UTSW 14 26766141 missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26724458 nonsense probably null
R2126:Dnah12 UTSW 14 26724458 nonsense probably null
R2207:Dnah12 UTSW 14 26781787 missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26739330 missense probably benign 0.06
R2511:Dnah12 UTSW 14 26769950 missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26693470 missense probably benign 0.04
R2875:Dnah12 UTSW 14 26876950 missense probably benign 0.05
R3551:Dnah12 UTSW 14 26770972 missense probably benign 0.01
R3713:Dnah12 UTSW 14 26812790 missense probably benign
R3729:Dnah12 UTSW 14 26706065 missense probably benign 0.02
R3799:Dnah12 UTSW 14 26770923 missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26710211 missense probably benign 0.00
R3892:Dnah12 UTSW 14 26856616 missense probably benign 0.03
R3921:Dnah12 UTSW 14 26771051 missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26723599 missense probably benign
R4065:Dnah12 UTSW 14 26770448 missense probably benign 0.02
R4113:Dnah12 UTSW 14 26693567 missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26709186 missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4260:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4348:Dnah12 UTSW 14 26814541 missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26815507 missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26871855 missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26770022 missense probably damaging 0.97
R4523:Dnah12 UTSW 14 26876958 missense possibly damaging 0.83
R4546:Dnah12 UTSW 14 26773014 missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26772594 missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26735758 missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26706839 missense probably benign 0.00
R4727:Dnah12 UTSW 14 26872317 missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26716629 nonsense probably null
R4879:Dnah12 UTSW 14 26718046 critical splice donor site probably null
R4893:Dnah12 UTSW 14 26710170 missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26734570 missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26861805 nonsense probably null
R4939:Dnah12 UTSW 14 26891524 missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26716700 missense probably benign 0.00
R5011:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5013:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5043:Dnah12 UTSW 14 26884190 missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26735697 missense probably benign 0.09
R5122:Dnah12 UTSW 14 26718000 missense probably benign 0.00
R5135:Dnah12 UTSW 14 26770477 missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26850926 nonsense probably null
R5154:Dnah12 UTSW 14 26849363 missense probably benign 0.12
R5206:Dnah12 UTSW 14 26769985 missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26693486 missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26773830 missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26879738 missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26814537 missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26774342 splice site probably null
R5389:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26859299 missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26771050 missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26710269 missense probably benign 0.01
R5681:Dnah12 UTSW 14 26815495 missense probably benign 0.32
R5824:Dnah12 UTSW 14 26770518 critical splice donor site probably null
R5863:Dnah12 UTSW 14 26854921 missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26706884 missense probably benign 0.09
R5912:Dnah12 UTSW 14 26770008 nonsense probably null
R5916:Dnah12 UTSW 14 26706918 missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26706867 missense probably benign 0.00
R5987:Dnah12 UTSW 14 26886871 missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26697341 missense probably benign 0.04
R6132:Dnah12 UTSW 14 26717911 missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26875270 missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26773685 missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26861769 missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26710257 missense probably benign 0.03
R6235:Dnah12 UTSW 14 26854804 missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26770482 missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26717974 missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26706834 missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26878051 missense probably benign 0.06
R6480:Dnah12 UTSW 14 26872455 missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26735710 missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26735692 missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26872749 missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26796223 missense probably benign 0.02
R6745:Dnah12 UTSW 14 26707228 missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26801513 missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26878079 missense probably damaging 1.00
R6982:Dnah12 UTSW 14 26799076 intron probably null
R7001:Dnah12 UTSW 14 26879724 missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26876998 missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26735680 missense probably benign
R7107:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7108:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7121:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7122:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26801413 missense probably damaging 0.99
R7150:Dnah12 UTSW 14 26861732 missense probably damaging 0.99
R7188:Dnah12 UTSW 14 26814413 missense probably benign 0.04
R7201:Dnah12 UTSW 14 26814622 missense probably benign 0.08
R7202:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26781485 missense probably damaging 0.99
R7205:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7206:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7219:Dnah12 UTSW 14 26854880 missense probably damaging 0.99
V7580:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26814480 missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26816288 missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26814645 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGAACTGCTGCCCAAGGCTAAG -3'
(R):5'- CTTTCCACAGAGGTTTTCACAACACAC -3'

Sequencing Primer
(F):5'- gtaatcctcctgtgtcagtctc -3'
(R):5'- GGTTTTCACAACACACACACG -3'
Posted On2014-04-13