Incidental Mutation 'R1639:Ncoa7'
ID173383
Institutional Source Beutler Lab
Gene Symbol Ncoa7
Ensembl Gene ENSMUSG00000039697
Gene Namenuclear receptor coactivator 7
Synonyms9030406N13Rik
MMRRC Submission 039675-MU
Accession Numbers

Genbank: NM_172495; MGI: 2444847

Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R1639 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location30628999-30803326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30701992 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 132 (L132R)
Ref Sequence ENSEMBL: ENSMUSP00000150021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068567] [ENSMUST00000213836] [ENSMUST00000215725] [ENSMUST00000215740] [ENSMUST00000215926]
Predicted Effect probably damaging
Transcript: ENSMUST00000068567
AA Change: L132R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066741
Gene: ENSMUSG00000039697
AA Change: L132R

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
LysM 118 161 2.24e-7 SMART
low complexity region 165 176 N/A INTRINSIC
TLDc 781 943 2.86e-64 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000213836
AA Change: L132R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215725
AA Change: L132R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215740
AA Change: L132R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215926
AA Change: L132R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000217398
AA Change: L58R
Meta Mutation Damage Score 0.246 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 96% (66/69)
Allele List at MGI

All alleles(108) : Gene trapped(108)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik T C 13: 34,944,250 I150T possibly damaging Het
Acss2 C A 2: 155,556,908 T425N probably benign Het
Adam18 T A 8: 24,652,152 I203L probably benign Het
Amigo2 A G 15: 97,245,998 M181T probably benign Het
Anks1 T A 17: 28,058,306 I1045N probably damaging Het
Ap3d1 C T 10: 80,730,010 V108I probably damaging Het
Arl8a C T 1: 135,152,823 R57* probably null Het
Atp12a A T 14: 56,384,068 D720V possibly damaging Het
Brpf3 T C 17: 28,824,068 probably null Het
C2 T C 17: 34,872,403 K95E probably benign Het
Cdk19 T C 10: 40,476,969 probably null Het
Cebpz T A 17: 78,934,606 I540L possibly damaging Het
Cep128 A G 12: 91,366,368 V41A probably damaging Het
Cog7 T C 7: 121,981,419 E56G probably damaging Het
Cylc2 T C 4: 51,228,310 V127A probably benign Het
Cyp2b23 A G 7: 26,686,417 V5A possibly damaging Het
Cyp8b1 A G 9: 121,914,890 Y459H probably benign Het
Dbpht2 A G 12: 74,299,158 noncoding transcript Het
Ddx24 T C 12: 103,411,319 probably null Het
Dgki C T 6: 36,937,364 C757Y probably damaging Het
Eef2k T A 7: 120,885,828 L306H probably damaging Het
Ephb2 T C 4: 136,693,905 N378S probably benign Het
Espl1 C T 15: 102,320,714 T1767I probably damaging Het
Fbn2 C A 18: 58,058,462 A1530S probably benign Het
Fndc11 A G 2: 181,221,581 S60G possibly damaging Het
Glb1l G T 1: 75,199,601 Q612K probably benign Het
Gpsm1 A G 2: 26,345,187 E371G probably damaging Het
Gtpbp2 G A 17: 46,165,771 probably null Het
Itch A G 2: 155,179,025 probably null Het
Itga2 T C 13: 114,857,296 T774A probably benign Het
Kit A G 5: 75,652,807 I881V probably damaging Het
Lpar5 T C 6: 125,081,601 L95P probably damaging Het
Lrp6 T C 6: 134,453,566 T1511A possibly damaging Het
Mgat4c T C 10: 102,378,281 Y42H probably damaging Het
Mpp3 G T 11: 102,023,442 T109K probably damaging Het
Msantd4 A G 9: 4,385,199 E308G probably damaging Het
Mug1 T C 6: 121,880,571 S1085P probably damaging Het
Myo5b A G 18: 74,707,916 H956R probably benign Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Olfr1254 T C 2: 89,789,245 T36A probably damaging Het
Pkhd1l1 G A 15: 44,540,955 V2327M probably damaging Het
Ppp1r9b T C 11: 94,996,610 Y59H probably damaging Het
Sema4c A T 1: 36,553,534 F152I probably benign Het
Slit2 A T 5: 48,259,654 Y1016F probably damaging Het
Spata31d1c T A 13: 65,036,039 V465D probably benign Het
Ssc5d T C 7: 4,928,417 C208R probably damaging Het
Stambpl1 T G 19: 34,236,307 V312G probably benign Het
Stim1 T A 7: 102,354,541 D60E probably benign Het
Syt13 T A 2: 92,945,971 V201D probably benign Het
Tcaim G A 9: 122,818,773 probably null Het
Tex15 T C 8: 33,570,817 S366P possibly damaging Het
Tpte G A 8: 22,320,897 R190H probably benign Het
Vmn1r4 T C 6: 56,957,075 V188A probably damaging Het
Vmn2r88 A G 14: 51,416,787 D542G probably damaging Het
Vps33b T A 7: 80,284,353 I257N probably damaging Het
Wwox G T 8: 114,445,378 G71* probably null Het
Zc3h11a G T 1: 133,624,708 Q554K probably benign Het
Zfp947 T C 17: 22,146,093 K200R probably benign Het
Zscan12 T A 13: 21,368,986 C327S probably damaging Het
Other mutations in Ncoa7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Ncoa7 APN 10 30690840 missense probably damaging 1.00
IGL01716:Ncoa7 APN 10 30662334 missense probably damaging 0.96
IGL02114:Ncoa7 APN 10 30662364 missense probably damaging 1.00
IGL02170:Ncoa7 APN 10 30689853 missense possibly damaging 0.94
IGL02436:Ncoa7 APN 10 30694147 missense probably damaging 1.00
IGL02499:Ncoa7 APN 10 30690889 missense probably benign 0.04
IGL02533:Ncoa7 APN 10 30690899 missense possibly damaging 0.87
IGL02533:Ncoa7 APN 10 30722785 missense probably damaging 1.00
IGL02590:Ncoa7 APN 10 30694163 missense probably damaging 1.00
IGL02657:Ncoa7 APN 10 30652976 missense probably damaging 1.00
IGL03065:Ncoa7 APN 10 30647997 missense probably damaging 1.00
IGL03088:Ncoa7 APN 10 30698125 splice site probably null
IGL03090:Ncoa7 APN 10 30662400 missense probably damaging 0.96
IGL03196:Ncoa7 APN 10 30647514 utr 3 prime probably benign
D6062:Ncoa7 UTSW 10 30722655 missense probably damaging 1.00
R0058:Ncoa7 UTSW 10 30647541 missense probably damaging 1.00
R0058:Ncoa7 UTSW 10 30647541 missense probably damaging 1.00
R0578:Ncoa7 UTSW 10 30701917 critical splice donor site probably null
R0729:Ncoa7 UTSW 10 30691579 missense probably benign 0.00
R1538:Ncoa7 UTSW 10 30694211 missense probably damaging 0.99
R1539:Ncoa7 UTSW 10 30771729 missense probably damaging 1.00
R1574:Ncoa7 UTSW 10 30694101 missense probably damaging 1.00
R1574:Ncoa7 UTSW 10 30694101 missense probably damaging 1.00
R1624:Ncoa7 UTSW 10 30704659 missense possibly damaging 0.87
R1655:Ncoa7 UTSW 10 30698245 critical splice acceptor site probably null
R1876:Ncoa7 UTSW 10 30698126 intron probably benign
R1885:Ncoa7 UTSW 10 30648452 missense possibly damaging 0.81
R1886:Ncoa7 UTSW 10 30648452 missense possibly damaging 0.81
R1887:Ncoa7 UTSW 10 30648452 missense possibly damaging 0.81
R1909:Ncoa7 UTSW 10 30689800 missense probably damaging 1.00
R1938:Ncoa7 UTSW 10 30698170 missense probably benign 0.02
R1965:Ncoa7 UTSW 10 30654430 nonsense probably null
R1978:Ncoa7 UTSW 10 30691299 missense probably benign
R2303:Ncoa7 UTSW 10 30654435 missense probably damaging 1.00
R3777:Ncoa7 UTSW 10 30689756 missense probably damaging 1.00
R3778:Ncoa7 UTSW 10 30689756 missense probably damaging 1.00
R4026:Ncoa7 UTSW 10 30722724 missense probably benign 0.02
R4230:Ncoa7 UTSW 10 30698257 splice site probably null
R4667:Ncoa7 UTSW 10 30690790 missense probably damaging 1.00
R4786:Ncoa7 UTSW 10 30655642 missense probably benign 0.28
R4809:Ncoa7 UTSW 10 30771762 missense possibly damaging 0.92
R4820:Ncoa7 UTSW 10 30648476 missense probably damaging 1.00
R4839:Ncoa7 UTSW 10 30722659 missense possibly damaging 0.93
R4861:Ncoa7 UTSW 10 30704612 missense probably benign
R4861:Ncoa7 UTSW 10 30704612 missense probably benign
R5271:Ncoa7 UTSW 10 30722729 missense probably benign 0.02
R5384:Ncoa7 UTSW 10 30722817 missense probably benign 0.00
R5418:Ncoa7 UTSW 10 30648039 missense probably damaging 1.00
R5964:Ncoa7 UTSW 10 30704636 missense probably damaging 1.00
R6257:Ncoa7 UTSW 10 30694177 missense probably damaging 1.00
R6683:Ncoa7 UTSW 10 30771721 missense probably damaging 0.99
R6813:Ncoa7 UTSW 10 30696192 missense probably damaging 1.00
R6910:Ncoa7 UTSW 10 30694121 missense possibly damaging 0.89
R7123:Ncoa7 UTSW 10 30654439 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TTGATGCCCCTGTAAACACAAGGATAC -3'
(R):5'- GGTCCAGAGATGAACCGCAGTTAAG -3'

Sequencing Primer
(F):5'- TCTTGGCTCTAAGGGAGATGAAC -3'
(R):5'- ccaagcagggtagtcacac -3'
Posted On2014-04-24