Incidental Mutation 'R1678:Lama1'
ID188315
Institutional Source Beutler Lab
Gene Symbol Lama1
Ensembl Gene ENSMUSG00000032796
Gene Namelaminin, alpha 1
SynonymsLama
MMRRC Submission 039714-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1678 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location67697265-67822645 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67810155 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 2482 (Y2482H)
Ref Sequence ENSEMBL: ENSMUSP00000043957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035471]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035471
AA Change: Y2482H

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000043957
Gene: ENSMUSG00000032796
AA Change: Y2482H

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
LamNT 23 275 1.2e-131 SMART
EGF_Lam 277 331 1e-5 SMART
EGF_Lam 334 401 6.6e-6 SMART
EGF_Lam 404 458 9.11e-9 SMART
EGF_Lam 461 507 8.12e-6 SMART
LamB 570 702 2.09e-57 SMART
EGF_like 715 746 3.36e0 SMART
EGF_Lam 749 795 7.01e-10 SMART
EGF_Lam 798 853 3.59e-7 SMART
EGF_Lam 856 906 1.53e-10 SMART
EGF_Lam 909 955 1.13e-13 SMART
EGF_Lam 958 1002 1.36e-7 SMART
EGF_Lam 1005 1048 7.29e-8 SMART
EGF_like 1034 1082 4.83e1 SMART
EGF_Lam 1051 1094 1.67e-7 SMART
EGF_Lam 1097 1154 1.32e-5 SMART
LamB 1220 1352 8.7e-46 SMART
Pfam:Laminin_EGF 1367 1397 1.7e-6 PFAM
EGF_Lam 1410 1456 7.12e-11 SMART
EGF_Lam 1459 1513 3.25e-5 SMART
EGF_like 1497 1547 6.41e1 SMART
EGF_Lam 1516 1560 1.71e-13 SMART
Pfam:Laminin_I 1574 1838 1.7e-91 PFAM
low complexity region 2012 2031 N/A INTRINSIC
low complexity region 2087 2098 N/A INTRINSIC
LamG 2145 2287 3.66e-30 SMART
LamG 2332 2473 5.98e-35 SMART
LamG 2513 2661 1.11e-29 SMART
low complexity region 2695 2708 N/A INTRINSIC
LamG 2743 2877 9.72e-35 SMART
LamG 2920 3056 4.63e-41 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the alpha 1 subunits of laminin. The laminins are a family of extracellular matrix glycoproteins that have a heterotrimeric structure consisting of an alpha, beta and gamma chain. These proteins make up a major component of the basement membrane and have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Mutations in this gene may be associated with Poretti-Boltshauser syndrome. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation with impaired formation of Reichert's membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik C A 6: 40,929,519 probably benign Het
4930402H24Rik A G 2: 130,814,273 V105A probably damaging Het
Abca17 A C 17: 24,335,620 I120S probably benign Het
Abcb5 A C 12: 118,965,329 probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acnat2 T A 4: 49,380,568 Y270F probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ankib1 A G 5: 3,706,301 I548T probably damaging Het
Apbb1ip A T 2: 22,874,880 probably null Het
Asb17 C T 3: 153,844,367 S12F probably damaging Het
Atad2b G A 12: 4,965,899 V542I possibly damaging Het
Atxn7 T C 14: 14,096,239 F515L probably damaging Het
Bicc1 A G 10: 70,943,518 L680P probably damaging Het
Bpifb6 G A 2: 153,908,642 R351H probably damaging Het
C4b A G 17: 34,743,650 F26S probably benign Het
Cadps A G 14: 12,517,802 probably null Het
Capza1 G T 3: 104,864,353 S9* probably null Het
Ccdc129 G T 6: 55,968,514 C740F probably benign Het
Ccl11 C T 11: 82,058,040 P25L probably damaging Het
Cdyl A T 13: 35,856,889 K306N probably damaging Het
Cnga3 T C 1: 37,261,498 V471A possibly damaging Het
Col4a4 T C 1: 82,486,659 K983E unknown Het
Cp A C 3: 19,972,717 K436N probably damaging Het
Csmd1 T A 8: 15,918,252 D3125V possibly damaging Het
Daw1 A T 1: 83,183,366 N143I probably damaging Het
Dmd T A X: 84,974,762 I3067N probably benign Het
Dnah11 T G 12: 117,933,845 N3550T possibly damaging Het
Dnm2 T C 9: 21,467,532 V129A possibly damaging Het
Dync1h1 A T 12: 110,665,662 probably null Het
Efemp1 G A 11: 28,916,942 E325K probably benign Het
Enox1 A G 14: 77,577,656 T85A probably benign Het
Faim2 C A 15: 99,520,336 V123F possibly damaging Het
Fgfr2 T C 7: 130,228,620 probably null Het
Fign T C 2: 63,980,374 E184G probably damaging Het
Fnd3c2 T C X: 106,237,699 T799A probably benign Het
Frem2 T C 3: 53,519,938 D2931G probably damaging Het
Fsip2 A G 2: 82,986,345 T4141A probably benign Het
Gigyf2 T A 1: 87,416,983 M546K probably benign Het
Gm21775 G A Y: 10,553,867 V139M probably damaging Het
Gpr83 G T 9: 14,866,849 V172F probably damaging Het
Jmjd4 A G 11: 59,453,612 Y179C probably damaging Het
Kcnq3 A G 15: 66,031,432 L143P probably damaging Het
Klhl41 T C 2: 69,670,939 V248A probably benign Het
Lamb2 A T 9: 108,483,686 probably null Het
Lclat1 G A 17: 73,196,720 G162R probably damaging Het
Map6 T C 7: 99,268,098 V26A probably damaging Het
Mdn1 A T 4: 32,663,050 D107V probably damaging Het
Metap1d T A 2: 71,524,777 V304D possibly damaging Het
Naca A G 10: 128,043,526 probably benign Het
Napg T C 18: 62,984,072 probably null Het
Nbeal1 T A 1: 60,260,334 F7L probably benign Het
Ndst2 T C 14: 20,724,514 T825A probably benign Het
Nsun2 T C 13: 69,627,103 I353T probably damaging Het
Nt5c3b T A 11: 100,436,210 I87F probably damaging Het
Nxf3 T C X: 136,075,521 D407G probably damaging Het
Olfr568 T A 7: 102,877,663 V181E probably damaging Het
Olfr891 A T 9: 38,180,637 F62Y possibly damaging Het
Osbpl3 A C 6: 50,336,213 probably null Het
P2rx3 T C 2: 85,022,467 T172A possibly damaging Het
Pcdh10 G T 3: 45,381,881 E877* probably null Het
Pcdhb9 A T 18: 37,401,629 K225N probably damaging Het
Plch1 A G 3: 63,740,694 S419P probably damaging Het
Prex2 T G 1: 11,285,089 I1538S possibly damaging Het
Rasl10a A G 11: 5,059,815 E121G possibly damaging Het
Rbbp8 A G 18: 11,732,315 T754A probably benign Het
Rictor T C 15: 6,756,471 V156A probably benign Het
Ryr1 A T 7: 29,116,154 Y104N probably damaging Het
Sctr G T 1: 120,036,439 probably null Het
Sptbn2 T C 19: 4,750,497 Y2247H probably damaging Het
Sqle C T 15: 59,324,509 R384W probably damaging Het
Srcin1 C A 11: 97,518,644 R1163L probably damaging Het
Srp72 A G 5: 76,980,307 Y125C probably damaging Het
Srrm2 T C 17: 23,818,986 S1535P probably benign Het
Sumf2 A G 5: 129,854,716 E125G possibly damaging Het
Tas2r144 A T 6: 42,215,556 I77F probably benign Het
Tcerg1 T C 18: 42,524,349 S299P unknown Het
Tcp1 T A 17: 12,920,423 N212K probably benign Het
Ttc7 G T 17: 87,361,901 G659C probably damaging Het
Ttn A T 2: 76,861,559 probably null Het
Ubtf A T 11: 102,308,978 D440E probably benign Het
Usp30 A G 5: 114,121,146 D428G probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r58 G A 7: 41,864,056 H388Y probably benign Het
Wdr60 A G 12: 116,225,970 S640P probably damaging Het
Zbtb49 T C 5: 38,213,694 D281G probably damaging Het
Zfp248 A G 6: 118,429,804 S174P probably benign Het
Zswim9 T C 7: 13,277,411 T4A probably benign Het
Other mutations in Lama1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Lama1 APN 17 67815928 missense probably benign
IGL00336:Lama1 APN 17 67813948 missense probably benign 0.07
IGL01066:Lama1 APN 17 67743326 missense probably damaging 1.00
IGL01140:Lama1 APN 17 67802933 missense probably benign 0.14
IGL01291:Lama1 APN 17 67738870 missense probably damaging 1.00
IGL01296:Lama1 APN 17 67745051 missense probably benign 0.27
IGL01317:Lama1 APN 17 67818701 missense probably damaging 1.00
IGL01490:Lama1 APN 17 67750584 missense possibly damaging 0.54
IGL01506:Lama1 APN 17 67785070 missense probably benign 0.01
IGL01508:Lama1 APN 17 67809361 splice site probably benign
IGL01522:Lama1 APN 17 67752774 splice site probably benign
IGL01530:Lama1 APN 17 67796790 missense probably benign 0.02
IGL01541:Lama1 APN 17 67785070 missense probably benign 0.01
IGL01677:Lama1 APN 17 67779148 missense probably benign 0.15
IGL01886:Lama1 APN 17 67807797 missense probably benign 0.36
IGL01994:Lama1 APN 17 67752439 missense probably benign 0.05
IGL02017:Lama1 APN 17 67764725 missense probably benign 0.00
IGL02021:Lama1 APN 17 67821626 missense probably damaging 1.00
IGL02026:Lama1 APN 17 67809292 missense possibly damaging 0.82
IGL02044:Lama1 APN 17 67811490 missense probably benign 0.01
IGL02120:Lama1 APN 17 67716789 missense probably damaging 1.00
IGL02425:Lama1 APN 17 67811485 missense probably benign 0.45
IGL02549:Lama1 APN 17 67790835 missense possibly damaging 0.93
IGL02642:Lama1 APN 17 67812366 missense probably benign 0.00
IGL02795:Lama1 APN 17 67738894 splice site probably null
IGL02798:Lama1 APN 17 67795191 splice site probably benign
IGL02863:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02870:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02876:Lama1 APN 17 67750692 critical splice donor site probably null
IGL02885:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02891:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02978:Lama1 APN 17 67786081 nonsense probably null
IGL03064:Lama1 APN 17 67779104 missense probably benign 0.01
IGL03076:Lama1 APN 17 67716799 missense possibly damaging 0.95
IGL03110:Lama1 APN 17 67798986 missense probably benign 0.04
IGL03143:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL03159:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL03268:Lama1 APN 17 67804536 missense probably damaging 0.99
ANU05:Lama1 UTSW 17 67738870 missense probably damaging 1.00
R0047:Lama1 UTSW 17 67795186 splice site probably benign
R0047:Lama1 UTSW 17 67795186 splice site probably benign
R0050:Lama1 UTSW 17 67782056 missense possibly damaging 0.66
R0096:Lama1 UTSW 17 67805413 missense probably benign 0.12
R0096:Lama1 UTSW 17 67805413 missense probably benign 0.12
R0111:Lama1 UTSW 17 67737498 missense probably damaging 0.98
R0116:Lama1 UTSW 17 67776923 missense probably benign 0.10
R0121:Lama1 UTSW 17 67798513 splice site probably benign
R0278:Lama1 UTSW 17 67810183 missense probably null 0.98
R0281:Lama1 UTSW 17 67817569 missense probably damaging 1.00
R0312:Lama1 UTSW 17 67775851 missense possibly damaging 0.45
R0419:Lama1 UTSW 17 67791610 critical splice donor site probably null
R0512:Lama1 UTSW 17 67779134 missense possibly damaging 0.67
R0514:Lama1 UTSW 17 67764698 missense probably benign 0.40
R0562:Lama1 UTSW 17 67815959 missense probably damaging 1.00
R0632:Lama1 UTSW 17 67752368 splice site probably benign
R0645:Lama1 UTSW 17 67773712 missense probably benign 0.01
R0712:Lama1 UTSW 17 67779042 splice site probably null
R0763:Lama1 UTSW 17 67772818 missense probably damaging 0.97
R0941:Lama1 UTSW 17 67775865 missense probably benign 0.10
R1025:Lama1 UTSW 17 67752898 missense probably benign 0.00
R1084:Lama1 UTSW 17 67804469 missense probably benign 0.12
R1103:Lama1 UTSW 17 67790947 missense probably damaging 0.98
R1420:Lama1 UTSW 17 67790947 missense probably damaging 0.98
R1430:Lama1 UTSW 17 67782155 missense possibly damaging 0.95
R1569:Lama1 UTSW 17 67780618 splice site probably null
R1575:Lama1 UTSW 17 67810409 missense possibly damaging 0.96
R1613:Lama1 UTSW 17 67807923 missense probably benign 0.42
R1620:Lama1 UTSW 17 67767033 missense probably benign 0.01
R1629:Lama1 UTSW 17 67805428 missense probably benign 0.00
R1645:Lama1 UTSW 17 67737682 missense probably benign 0.14
R1652:Lama1 UTSW 17 67807846 missense probably damaging 0.97
R1674:Lama1 UTSW 17 67791244 missense probably benign
R1710:Lama1 UTSW 17 67753791 missense probably benign 0.00
R1712:Lama1 UTSW 17 67717186 missense possibly damaging 0.95
R1737:Lama1 UTSW 17 67802921 missense probably benign 0.36
R1757:Lama1 UTSW 17 67763836 missense probably benign 0.40
R1757:Lama1 UTSW 17 67697383 missense unknown
R1813:Lama1 UTSW 17 67791223 missense probably benign
R1896:Lama1 UTSW 17 67791223 missense probably benign
R1945:Lama1 UTSW 17 67745853 missense probably benign 0.14
R2086:Lama1 UTSW 17 67817623 missense probably damaging 1.00
R2149:Lama1 UTSW 17 67773865 missense possibly damaging 0.95
R2178:Lama1 UTSW 17 67769515 missense probably benign 0.07
R2183:Lama1 UTSW 17 67791009 missense probably damaging 0.98
R2197:Lama1 UTSW 17 67752941 missense probably benign 0.02
R2213:Lama1 UTSW 17 67777034 nonsense probably null
R2260:Lama1 UTSW 17 67737507 missense probably damaging 0.96
R2356:Lama1 UTSW 17 67810114 missense probably damaging 1.00
R2420:Lama1 UTSW 17 67750553 missense probably benign 0.00
R2421:Lama1 UTSW 17 67750553 missense probably benign 0.00
R2422:Lama1 UTSW 17 67750553 missense probably benign 0.00
R2424:Lama1 UTSW 17 67798665 missense probably benign 0.09
R2442:Lama1 UTSW 17 67768317 missense probably benign 0.04
R3147:Lama1 UTSW 17 67737658 missense probably damaging 0.98
R3414:Lama1 UTSW 17 67737603 missense probably damaging 1.00
R3683:Lama1 UTSW 17 67768333 missense probably benign 0.40
R3820:Lama1 UTSW 17 67779046 splice site probably null
R3821:Lama1 UTSW 17 67779046 splice site probably null
R3822:Lama1 UTSW 17 67779046 splice site probably null
R4012:Lama1 UTSW 17 67812373 nonsense probably null
R4113:Lama1 UTSW 17 67764703 missense probably benign 0.01
R4133:Lama1 UTSW 17 67750655 missense probably damaging 0.98
R4133:Lama1 UTSW 17 67812486 missense probably damaging 1.00
R4259:Lama1 UTSW 17 67752418 missense possibly damaging 0.95
R4278:Lama1 UTSW 17 67791517 missense probably null 0.00
R4321:Lama1 UTSW 17 67771083 missense probably benign 0.03
R4374:Lama1 UTSW 17 67804518 missense probably benign 0.00
R4386:Lama1 UTSW 17 67773712 missense probably benign 0.01
R4463:Lama1 UTSW 17 67761700 missense probably damaging 1.00
R4629:Lama1 UTSW 17 67805360 critical splice acceptor site probably null
R4630:Lama1 UTSW 17 67794300 missense probably benign 0.00
R4633:Lama1 UTSW 17 67798584 missense probably damaging 0.96
R4668:Lama1 UTSW 17 67752434 missense probably benign 0.27
R4684:Lama1 UTSW 17 67773778 missense possibly damaging 0.88
R4745:Lama1 UTSW 17 67738780 missense probably damaging 1.00
R4786:Lama1 UTSW 17 67773859 missense possibly damaging 0.77
R4797:Lama1 UTSW 17 67716775 missense probably benign 0.04
R4803:Lama1 UTSW 17 67809271 missense probably damaging 1.00
R4925:Lama1 UTSW 17 67794314 missense probably benign 0.02
R4939:Lama1 UTSW 17 67737475 missense possibly damaging 0.91
R4952:Lama1 UTSW 17 67767566 critical splice donor site probably null
R4975:Lama1 UTSW 17 67738834 missense possibly damaging 0.95
R4977:Lama1 UTSW 17 67737682 missense probably damaging 1.00
R5039:Lama1 UTSW 17 67745893 missense possibly damaging 0.66
R5047:Lama1 UTSW 17 67743281 nonsense probably null
R5195:Lama1 UTSW 17 67764800 missense probably benign 0.13
R5230:Lama1 UTSW 17 67745083 nonsense probably null
R5236:Lama1 UTSW 17 67804492 missense probably benign 0.24
R5254:Lama1 UTSW 17 67756716 missense probably benign 0.01
R5345:Lama1 UTSW 17 67817563 missense probably benign
R5438:Lama1 UTSW 17 67800774 missense possibly damaging 0.92
R5521:Lama1 UTSW 17 67780894 nonsense probably null
R5568:Lama1 UTSW 17 67768298 critical splice acceptor site probably null
R5645:Lama1 UTSW 17 67802948 missense probably damaging 1.00
R5665:Lama1 UTSW 17 67770987 missense probably damaging 1.00
R5727:Lama1 UTSW 17 67815224 missense possibly damaging 0.81
R5757:Lama1 UTSW 17 67738787 missense possibly damaging 0.59
R5795:Lama1 UTSW 17 67796727 missense probably benign 0.02
R5857:Lama1 UTSW 17 67807843 missense probably damaging 0.99
R5894:Lama1 UTSW 17 67779047 critical splice acceptor site probably null
R5974:Lama1 UTSW 17 67773727 missense probably benign 0.31
R6032:Lama1 UTSW 17 67750643 missense probably benign 0.01
R6032:Lama1 UTSW 17 67750643 missense probably benign 0.01
R6120:Lama1 UTSW 17 67780617 critical splice donor site probably null
R6219:Lama1 UTSW 17 67790856 missense probably benign 0.08
R6224:Lama1 UTSW 17 67802987 missense possibly damaging 0.56
R6249:Lama1 UTSW 17 67798604 missense probably benign
R6265:Lama1 UTSW 17 67750655 missense probably damaging 0.98
R6276:Lama1 UTSW 17 67784088 splice site probably null
R6284:Lama1 UTSW 17 67810096 missense probably damaging 0.99
R6337:Lama1 UTSW 17 67786019 missense probably benign 0.27
R6414:Lama1 UTSW 17 67746910 critical splice donor site probably null
R6631:Lama1 UTSW 17 67774482 missense probably benign 0.21
R6659:Lama1 UTSW 17 67818635 missense probably damaging 1.00
R6660:Lama1 UTSW 17 67804500 missense probably benign 0.05
R6677:Lama1 UTSW 17 67795233 missense probably benign 0.14
R6763:Lama1 UTSW 17 67746873 missense unknown
R6787:Lama1 UTSW 17 67784025 missense unknown
R6831:Lama1 UTSW 17 67756754 missense possibly damaging 0.89
R6855:Lama1 UTSW 17 67782155 missense possibly damaging 0.95
R6910:Lama1 UTSW 17 67791464 missense possibly damaging 0.60
R6934:Lama1 UTSW 17 67774543 missense probably benign 0.04
R6945:Lama1 UTSW 17 67813866 missense
R6984:Lama1 UTSW 17 67779112 missense
R6989:Lama1 UTSW 17 67753758 missense
V8831:Lama1 UTSW 17 67752883 missense probably benign 0.00
X0024:Lama1 UTSW 17 67738888 missense probably damaging 1.00
X0028:Lama1 UTSW 17 67767422 missense probably benign 0.00
X0028:Lama1 UTSW 17 67794310 missense probably benign 0.06
X0066:Lama1 UTSW 17 67811566 missense probably damaging 1.00
Z1088:Lama1 UTSW 17 67752883 missense probably benign 0.00
Z1088:Lama1 UTSW 17 67771082 missense probably benign 0.25
Z1088:Lama1 UTSW 17 67810171 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGGATTGCCTCATTCTAAGGCTG -3'
(R):5'- GGTAGAAATTCCCCACACACGTCTC -3'

Sequencing Primer
(F):5'- CTGTGAGGTATGATGTGAAACCAC -3'
(R):5'- ACTCACACTCTGGATAGGCTG -3'
Posted On2014-05-09