Incidental Mutation 'R0727:2810474O19Rik'
ID200638
Institutional Source Beutler Lab
Gene Symbol 2810474O19Rik
Ensembl Gene ENSMUSG00000032712
Gene NameRIKEN cDNA 2810474O19 gene
SynonymsGET
MMRRC Submission 038909-MU
Accession Numbers

Genbank: NM_026054; MGI: 1914496

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0727 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location149309414-149335663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149325822 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 122 (N122S)
Ref Sequence ENSEMBL: ENSMUSP00000120770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046689] [ENSMUST00000100765] [ENSMUST00000127680] [ENSMUST00000130664] [ENSMUST00000185930] [ENSMUST00000187881] [ENSMUST00000189837] [ENSMUST00000189932] [ENSMUST00000190785]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046689
AA Change: N122S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041180
Gene: ENSMUSG00000032712
AA Change: N122S

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100765
AA Change: N122S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098328
Gene: ENSMUSG00000032712
AA Change: N122S

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000127680
AA Change: N122S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000130664
AA Change: N122S

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000185930
Predicted Effect probably benign
Transcript: ENSMUST00000187881
Predicted Effect possibly damaging
Transcript: ENSMUST00000189837
AA Change: N122S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139660
Gene: ENSMUSG00000032712
AA Change: N122S

DomainStartEndE-ValueType
Pfam:DUF4617 451 1511 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000189932
AA Change: N122S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140026
Gene: ENSMUSG00000032712
AA Change: N122S

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190785
AA Change: N122S

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000139624
Gene: ENSMUSG00000032712
AA Change: N122S

DomainStartEndE-ValueType
Pfam:DUF4617 451 1173 9.4e-255 PFAM
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency 99% (70/71)
Allele List at MGI

All alleles(126) : Targeted, knock-out(1) Gene trapped(125)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik A G 13: 98,984,227 V97A probably benign Het
Actr3b T C 5: 25,811,939 V83A possibly damaging Het
Adam2 A G 14: 66,029,731 I693T probably damaging Het
Adamts1 T C 16: 85,798,648 D214G possibly damaging Het
Atp6v1h T A 1: 5,084,558 Y36* probably null Het
Cacna1d A G 14: 30,130,115 probably null Het
Catsperb G T 12: 101,594,355 probably null Het
Ccdc88b T C 19: 6,854,214 M482V probably benign Het
Cemip T C 7: 83,961,578 K723E probably benign Het
Cep112 G A 11: 108,506,554 R375H probably damaging Het
Cpne7 T C 8: 123,126,286 S211P probably damaging Het
Csde1 A G 3: 103,043,638 T191A probably benign Het
Dapk3 A G 10: 81,190,262 Y129C probably damaging Het
Dlc1 A G 8: 36,572,674 V1027A probably damaging Het
Ergic2 T A 6: 148,199,400 probably benign Het
Evpl T C 11: 116,232,485 H307R probably damaging Het
Faah A G 4: 116,005,060 I242T probably damaging Het
Farsa T A 8: 84,861,304 probably null Het
Fat3 A C 9: 15,996,699 L2669R probably damaging Het
Fgfr4 C A 13: 55,156,228 probably null Het
Gnl3 A G 14: 31,017,077 S55P probably damaging Het
Grhl3 T A 4: 135,546,254 K562N possibly damaging Het
Hoxa9 A G 6: 52,224,314 V249A probably damaging Het
Hyal1 T C 9: 107,578,402 S304P possibly damaging Het
Igf1r T C 7: 68,212,158 probably null Het
Kif3c A G 12: 3,366,776 T266A probably benign Het
Lrp1b T C 2: 40,750,944 D3496G probably benign Het
Man2b1 T G 8: 85,091,526 V442G probably damaging Het
Mast1 T C 8: 84,921,415 Y479C probably damaging Het
Mei1 A G 15: 82,070,149 T52A probably benign Het
Micall1 A G 15: 79,120,778 D150G probably benign Het
Muc4 A G 16: 32,769,847 M2927V probably benign Het
Olfr1065 T C 2: 86,445,938 M15V probably benign Het
Olfr1082 A T 2: 86,594,380 Y149* probably null Het
Olfr1436 T C 19: 12,299,094 I13V probably benign Het
Olfr153 T A 2: 87,532,901 Y289* probably null Het
Olfr504 C T 7: 108,565,108 R229H probably benign Het
Olfr745 G T 14: 50,643,003 V241L probably damaging Het
Pabpc2 A C 18: 39,775,134 Q484P probably benign Het
Pbld2 T A 10: 63,067,519 V125D probably benign Het
Pkhd1l1 A G 15: 44,535,788 T2083A possibly damaging Het
Pum2 A G 12: 8,744,465 E785G probably damaging Het
Qser1 A G 2: 104,777,311 probably benign Het
R3hcc1l A G 19: 42,576,075 D29G probably damaging Het
Rabep1 T A 11: 70,900,492 Y180* probably null Het
Rassf5 T C 1: 131,181,265 S140G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfpl4 T A 7: 5,115,293 I93L probably benign Het
Rnf219 G C 14: 104,480,188 L250V probably damaging Het
Ryr2 C T 13: 11,566,885 G4798D probably damaging Het
Scaf11 G A 15: 96,419,443 P747S probably damaging Het
Sgo2b T G 8: 63,927,782 K672T probably damaging Het
Smg1 T C 7: 118,166,422 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssh3 G T 19: 4,263,991 H439Q probably damaging Het
Steap3 T A 1: 120,227,817 T471S possibly damaging Het
Stk33 T A 7: 109,321,518 I208L probably damaging Het
Sucnr1 A G 3: 60,086,660 Y203C probably benign Het
Tlr11 T C 14: 50,361,469 I304T possibly damaging Het
Top2a A T 11: 99,012,148 C404* probably null Het
Trim43a G A 9: 88,582,146 E37K probably benign Het
Zcwpw1 T C 5: 137,810,807 probably benign Het
Zfhx4 A T 3: 5,401,073 H2097L probably damaging Het
Zfp874b T C 13: 67,474,712 K156E probably damaging Het
Zfyve16 T C 13: 92,493,878 K1413E possibly damaging Het
Other mutations in 2810474O19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:2810474O19Rik APN 6 149334750 utr 3 prime probably benign
IGL01401:2810474O19Rik APN 6 149326896 missense probably damaging 0.98
IGL01461:2810474O19Rik APN 6 149331515 unclassified probably benign
IGL01610:2810474O19Rik APN 6 149328951 missense probably benign 0.01
IGL02873:2810474O19Rik APN 6 149327040 missense probably damaging 1.00
IGL03202:2810474O19Rik APN 6 149326439 missense probably benign 0.08
grand_junction UTSW 6 149327878 missense probably damaging 0.98
grand_marais UTSW 6 149326460 nonsense probably null
3-1:2810474O19Rik UTSW 6 149327729 missense probably damaging 0.98
B6584:2810474O19Rik UTSW 6 149329346 missense probably damaging 0.96
PIT4280001:2810474O19Rik UTSW 6 149325525 missense probably benign 0.23
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0243:2810474O19Rik UTSW 6 149326241 missense probably damaging 1.00
R0620:2810474O19Rik UTSW 6 149328375 missense probably damaging 1.00
R0633:2810474O19Rik UTSW 6 149325701 missense probably benign 0.00
R0904:2810474O19Rik UTSW 6 149328269 missense probably damaging 0.99
R1221:2810474O19Rik UTSW 6 149326221 missense probably benign 0.24
R1282:2810474O19Rik UTSW 6 149329172 nonsense probably null
R1435:2810474O19Rik UTSW 6 149326082 missense probably benign 0.04
R1452:2810474O19Rik UTSW 6 149326632 missense probably damaging 1.00
R1587:2810474O19Rik UTSW 6 149326520 missense probably damaging 1.00
R1912:2810474O19Rik UTSW 6 149328844 missense possibly damaging 0.80
R1926:2810474O19Rik UTSW 6 149329404 missense probably benign 0.39
R1978:2810474O19Rik UTSW 6 149326432 missense probably damaging 0.97
R2035:2810474O19Rik UTSW 6 149329226 missense possibly damaging 0.91
R2136:2810474O19Rik UTSW 6 149328822 missense probably benign 0.01
R2333:2810474O19Rik UTSW 6 149327511 missense probably damaging 1.00
R2360:2810474O19Rik UTSW 6 149334647 missense probably benign 0.05
R3027:2810474O19Rik UTSW 6 149329035 missense probably benign 0.02
R3121:2810474O19Rik UTSW 6 149329243 nonsense probably null
R3707:2810474O19Rik UTSW 6 149329113 missense probably damaging 0.98
R4204:2810474O19Rik UTSW 6 149329544 nonsense probably null
R4247:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4249:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4304:2810474O19Rik UTSW 6 149326238 nonsense probably null
R4385:2810474O19Rik UTSW 6 149326208 missense possibly damaging 0.93
R4702:2810474O19Rik UTSW 6 149329403 missense probably benign 0.05
R4747:2810474O19Rik UTSW 6 149326894 missense probably damaging 0.96
R4912:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4913:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4965:2810474O19Rik UTSW 6 149328398 nonsense probably null
R4971:2810474O19Rik UTSW 6 149325599 unclassified probably benign
R5077:2810474O19Rik UTSW 6 149326030 missense probably benign 0.14
R5213:2810474O19Rik UTSW 6 149326053 missense possibly damaging 0.77
R5382:2810474O19Rik UTSW 6 149326460 nonsense probably null
R5418:2810474O19Rik UTSW 6 149326136 missense probably damaging 1.00
R5452:2810474O19Rik UTSW 6 149329113 nonsense probably null
R5498:2810474O19Rik UTSW 6 149328240 missense probably damaging 0.99
R5673:2810474O19Rik UTSW 6 149327993 nonsense probably null
R5690:2810474O19Rik UTSW 6 149328237 missense possibly damaging 0.95
R5916:2810474O19Rik UTSW 6 149326578 missense probably damaging 0.99
R5917:2810474O19Rik UTSW 6 149334681 missense probably damaging 0.98
R6160:2810474O19Rik UTSW 6 149331507 critical splice donor site probably null
R6280:2810474O19Rik UTSW 6 149327057 missense probably damaging 1.00
R6326:2810474O19Rik UTSW 6 149328995 missense probably damaging 0.96
R6396:2810474O19Rik UTSW 6 149327919 missense probably damaging 1.00
R6702:2810474O19Rik UTSW 6 149327878 missense probably damaging 0.98
R6972:2810474O19Rik UTSW 6 149326109 missense probably damaging 0.99
R7127:2810474O19Rik UTSW 6 149327945 missense possibly damaging 0.95
R7168:2810474O19Rik UTSW 6 149327843 missense probably benign
R7316:2810474O19Rik UTSW 6 149326638 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTTTCACAGCCACTTCTGAGCG -3'
(R):5'- GCTGAGCATTCTGCACATGTTGG -3'

Sequencing Primer
(F):5'- ATTGTGGCCTCACAGTCTTC -3'
(R):5'- GGATGTATACTGTGTCCAGTCAACC -3'
Posted On2014-05-23