Incidental Mutation 'R1221:2810474O19Rik'
ID100086
Institutional Source Beutler Lab
Gene Symbol 2810474O19Rik
Ensembl Gene ENSMUSG00000032712
Gene NameRIKEN cDNA 2810474O19 gene
SynonymsGET
MMRRC Submission 039290-MU
Accession Numbers

Genbank: NM_026054; MGI: 1914496

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1221 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location149309414-149335663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 149326221 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 255 (V255E)
Ref Sequence ENSEMBL: ENSMUSP00000115573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046689] [ENSMUST00000100765] [ENSMUST00000127680] [ENSMUST00000130664] [ENSMUST00000185930] [ENSMUST00000187881] [ENSMUST00000189837] [ENSMUST00000189932] [ENSMUST00000190785]
Predicted Effect probably benign
Transcript: ENSMUST00000046689
AA Change: V255E

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000041180
Gene: ENSMUSG00000032712
AA Change: V255E

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100765
AA Change: V255E

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000098328
Gene: ENSMUSG00000032712
AA Change: V255E

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127680
Predicted Effect probably benign
Transcript: ENSMUST00000130664
AA Change: V255E

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000185930
Predicted Effect probably benign
Transcript: ENSMUST00000187881
Predicted Effect probably benign
Transcript: ENSMUST00000189837
AA Change: V255E

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139660
Gene: ENSMUSG00000032712
AA Change: V255E

DomainStartEndE-ValueType
Pfam:DUF4617 451 1511 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189932
AA Change: V255E

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000140026
Gene: ENSMUSG00000032712
AA Change: V255E

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190785
AA Change: V255E

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000139624
Gene: ENSMUSG00000032712
AA Change: V255E

DomainStartEndE-ValueType
Pfam:DUF4617 451 1173 9.4e-255 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI

All alleles(126) : Targeted, knock-out(1) Gene trapped(125)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,965,478 S668P unknown Het
Anks1 A G 17: 28,050,642 Q770R possibly damaging Het
Apc2 G A 10: 80,306,380 V378I probably damaging Het
Apeh A G 9: 108,092,609 V184A probably benign Het
AU018091 A G 7: 3,158,877 F404S probably damaging Het
Bap1 T C 14: 31,257,651 L537P probably damaging Het
Bhlha15 A G 5: 144,191,523 Y151C probably damaging Het
Bmp8b A T 4: 123,114,711 T157S probably damaging Het
Btbd1 G T 7: 81,818,257 H172N possibly damaging Het
C1rl A G 6: 124,493,981 R83G probably benign Het
Cep104 A G 4: 153,988,445 T387A probably benign Het
Cfi A T 3: 129,872,969 Q447L probably damaging Het
Coq6 A G 12: 84,371,527 E295G possibly damaging Het
Dclre1a T C 19: 56,531,268 T978A possibly damaging Het
Dlc1 T C 8: 36,584,831 D582G probably benign Het
Dlgap2 A G 8: 14,726,952 T65A probably benign Het
Dock5 G A 14: 67,759,161 S1711L probably benign Het
Drc3 A C 11: 60,384,226 I338L probably benign Het
Dsc1 A T 18: 20,114,542 C5* probably null Het
F5 A G 1: 164,161,799 Y90C probably damaging Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm136 G T 4: 34,744,127 A239E possibly damaging Het
Gm4952 A T 19: 12,623,695 D93V possibly damaging Het
Gramd1c T C 16: 43,989,864 T454A possibly damaging Het
Gstm6 A G 3: 107,941,102 I58T probably damaging Het
Kdm3b C T 18: 34,808,245 S263L possibly damaging Het
Kdm5b G C 1: 134,599,091 S317T probably damaging Het
Myo15b A G 11: 115,886,720 R71G possibly damaging Het
Nlrp1b G A 11: 71,181,464 P518S probably benign Het
Nme5 A T 18: 34,571,522 I90N probably damaging Het
Nrxn1 T A 17: 90,643,294 T478S probably damaging Het
Odf3 G T 7: 140,848,383 W10L probably damaging Het
Olfr936 A C 9: 39,047,187 D77E probably damaging Het
Osmr G A 15: 6,823,561 Q617* probably null Het
Pcsk5 T C 19: 17,837,148 D2G possibly damaging Het
Pdpn G A 4: 143,274,038 R75C probably damaging Het
Pidd1 A T 7: 141,438,812 F842Y probably damaging Het
Sema3a A G 5: 13,516,223 Q158R probably benign Het
Setbp1 T A 18: 78,856,583 R1290W probably damaging Het
Slc20a1 G A 2: 129,208,404 G494D probably benign Het
Spag17 A G 3: 99,982,268 E151G possibly damaging Het
Stt3b A G 9: 115,257,499 F351L probably benign Het
Tas1r2 A G 4: 139,669,125 M592V probably benign Het
Tbcd A G 11: 121,497,083 T347A probably benign Het
Tmem109 C A 19: 10,874,369 R37L possibly damaging Het
Tmem67 G A 4: 12,045,871 S862L possibly damaging Het
Ttn T A 2: 76,951,513 D1017V probably damaging Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfyve16 T C 13: 92,508,305 S1130G possibly damaging Het
Other mutations in 2810474O19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:2810474O19Rik APN 6 149334750 utr 3 prime probably benign
IGL01401:2810474O19Rik APN 6 149326896 missense probably damaging 0.98
IGL01461:2810474O19Rik APN 6 149331515 unclassified probably benign
IGL01610:2810474O19Rik APN 6 149328951 missense probably benign 0.01
IGL02873:2810474O19Rik APN 6 149327040 missense probably damaging 1.00
IGL03202:2810474O19Rik APN 6 149326439 missense probably benign 0.08
grand_junction UTSW 6 149327878 missense probably damaging 0.98
grand_marais UTSW 6 149326460 nonsense probably null
3-1:2810474O19Rik UTSW 6 149327729 missense probably damaging 0.98
B6584:2810474O19Rik UTSW 6 149329346 missense probably damaging 0.96
PIT4280001:2810474O19Rik UTSW 6 149325525 missense probably benign 0.23
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0243:2810474O19Rik UTSW 6 149326241 missense probably damaging 1.00
R0620:2810474O19Rik UTSW 6 149328375 missense probably damaging 1.00
R0633:2810474O19Rik UTSW 6 149325701 missense probably benign 0.00
R0727:2810474O19Rik UTSW 6 149325822 missense possibly damaging 0.94
R0904:2810474O19Rik UTSW 6 149328269 missense probably damaging 0.99
R1282:2810474O19Rik UTSW 6 149329172 nonsense probably null
R1435:2810474O19Rik UTSW 6 149326082 missense probably benign 0.04
R1452:2810474O19Rik UTSW 6 149326632 missense probably damaging 1.00
R1587:2810474O19Rik UTSW 6 149326520 missense probably damaging 1.00
R1912:2810474O19Rik UTSW 6 149328844 missense possibly damaging 0.80
R1926:2810474O19Rik UTSW 6 149329404 missense probably benign 0.39
R1978:2810474O19Rik UTSW 6 149326432 missense probably damaging 0.97
R2035:2810474O19Rik UTSW 6 149329226 missense possibly damaging 0.91
R2136:2810474O19Rik UTSW 6 149328822 missense probably benign 0.01
R2333:2810474O19Rik UTSW 6 149327511 missense probably damaging 1.00
R2360:2810474O19Rik UTSW 6 149334647 missense probably benign 0.05
R3027:2810474O19Rik UTSW 6 149329035 missense probably benign 0.02
R3121:2810474O19Rik UTSW 6 149329243 nonsense probably null
R3707:2810474O19Rik UTSW 6 149329113 missense probably damaging 0.98
R4204:2810474O19Rik UTSW 6 149329544 nonsense probably null
R4247:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4249:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4304:2810474O19Rik UTSW 6 149326238 nonsense probably null
R4385:2810474O19Rik UTSW 6 149326208 missense possibly damaging 0.93
R4702:2810474O19Rik UTSW 6 149329403 missense probably benign 0.05
R4747:2810474O19Rik UTSW 6 149326894 missense probably damaging 0.96
R4912:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4913:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4965:2810474O19Rik UTSW 6 149328398 nonsense probably null
R4971:2810474O19Rik UTSW 6 149325599 unclassified probably benign
R5077:2810474O19Rik UTSW 6 149326030 missense probably benign 0.14
R5213:2810474O19Rik UTSW 6 149326053 missense possibly damaging 0.77
R5382:2810474O19Rik UTSW 6 149326460 nonsense probably null
R5418:2810474O19Rik UTSW 6 149326136 missense probably damaging 1.00
R5452:2810474O19Rik UTSW 6 149329113 nonsense probably null
R5498:2810474O19Rik UTSW 6 149328240 missense probably damaging 0.99
R5673:2810474O19Rik UTSW 6 149327993 nonsense probably null
R5690:2810474O19Rik UTSW 6 149328237 missense possibly damaging 0.95
R5916:2810474O19Rik UTSW 6 149326578 missense probably damaging 0.99
R5917:2810474O19Rik UTSW 6 149334681 missense probably damaging 0.98
R6160:2810474O19Rik UTSW 6 149331507 critical splice donor site probably null
R6280:2810474O19Rik UTSW 6 149327057 missense probably damaging 1.00
R6326:2810474O19Rik UTSW 6 149328995 missense probably damaging 0.96
R6396:2810474O19Rik UTSW 6 149327919 missense probably damaging 1.00
R6702:2810474O19Rik UTSW 6 149327878 missense probably damaging 0.98
R6972:2810474O19Rik UTSW 6 149326109 missense probably damaging 0.99
R7127:2810474O19Rik UTSW 6 149327945 missense possibly damaging 0.95
R7168:2810474O19Rik UTSW 6 149327843 missense probably benign
R7316:2810474O19Rik UTSW 6 149326638 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCATCCACCACAGAATCAGCTTGTC -3'
(R):5'- TCTGCCACTGCTGCTTAAAGCC -3'

Sequencing Primer
(F):5'- GTCAGGGACTTAATCACTTCATACC -3'
(R):5'- GCTGCTTAAAGCCTCTGTAAGTATC -3'
Posted On2014-01-15