Incidental Mutation 'R2126:Rnf213'
ID229925
Institutional Source Beutler Lab
Gene Symbol Rnf213
Ensembl Gene ENSMUSG00000070327
Gene Namering finger protein 213
SynonymsD11Ertd759e
MMRRC Submission 040129-MU
Accession Numbers

Genbank: XM_001477846.2; Ensembl: ENSMUST00000131035, ENSMUST00000082107, ENSMUST00000093902, ENSMUST00000169768, ENSMUST00000172235

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2126 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location119393100-119487418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119450201 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 3556 (Q3556R)
Ref Sequence ENSEMBL: ENSMUSP00000115063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]
Predicted Effect probably benign
Transcript: ENSMUST00000093902
AA Change: Q3557R

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: Q3557R

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1546 1558 N/A INTRINSIC
AAA 2373 2515 2.82e-2 SMART
AAA 2722 2890 3.63e-1 SMART
low complexity region 3449 3459 N/A INTRINSIC
RING 3947 3985 8.69e-5 SMART
Blast:PP2Ac 4544 4722 3e-66 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000131035
AA Change: Q3556R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: Q3556R

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1113 1127 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
AAA 2372 2514 2.82e-2 SMART
AAA 2721 2889 3.63e-1 SMART
low complexity region 3448 3458 N/A INTRINSIC
RING 3946 3984 8.69e-5 SMART
Blast:PP2Ac 4542 4720 3e-66 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207133
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A G 3: 60,039,645 T255A possibly damaging Het
Acat3 C T 17: 12,927,407 A230T probably benign Het
Acsl1 C A 8: 46,533,626 P650Q probably benign Het
Adgrl3 T A 5: 81,512,536 I316N probably damaging Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
AI429214 T A 8: 36,994,208 V170E probably benign Het
Akap13 G A 7: 75,725,304 G1895S possibly damaging Het
Alpk2 G A 18: 65,350,368 Q190* probably null Het
Aox3 C A 1: 58,158,216 Q574K probably benign Het
Apeh A G 9: 108,085,667 Y702H probably damaging Het
Aqp11 A G 7: 97,737,485 I151T probably benign Het
Arhgap28 A G 17: 67,869,015 V363A possibly damaging Het
Arhgef18 A G 8: 3,451,939 N699S probably damaging Het
Asnsd1 A G 1: 53,347,317 S384P probably benign Het
Atl1 G T 12: 69,931,657 probably null Het
Atp13a2 A T 4: 140,995,391 D203V possibly damaging Het
Axdnd1 A T 1: 156,333,214 N164K probably benign Het
Bnipl T A 3: 95,245,683 I162F probably damaging Het
Cacna1d A T 14: 30,123,163 L655I probably damaging Het
Canx T C 11: 50,304,358 I294M probably damaging Het
Casz1 T C 4: 148,946,064 F1180S probably damaging Het
Cav3 T C 6: 112,472,383 Y121H probably benign Het
Cd4 A C 6: 124,870,536 S222A probably benign Het
Cds1 T C 5: 101,812,550 I289T probably benign Het
Cep112 T C 11: 108,508,258 F328L probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap44 A T 16: 44,410,475 D273V probably benign Het
Clec7a C T 6: 129,470,955 G49D probably benign Het
Col22a1 G A 15: 71,857,253 Q599* probably null Het
Col6a5 T A 9: 105,945,600 H186L unknown Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnah12 A T 14: 26,724,458 R725* probably null Het
Dnajc10 G A 2: 80,350,734 probably null Het
Edem3 A T 1: 151,794,731 H337L possibly damaging Het
Eif2ak4 A T 2: 118,422,123 H392L probably benign Het
Ercc6l2 G A 13: 63,848,771 V365I probably damaging Het
Fam129a A C 1: 151,696,135 E277A probably damaging Het
Fam129a A G 1: 151,709,133 I494V possibly damaging Het
Fan1 T C 7: 64,346,888 E978G probably damaging Het
Fcrl6 C T 1: 172,599,248 V44M probably benign Het
Gaa G A 11: 119,270,282 W50* probably null Het
Gm10032 T C 14: 66,792,778 noncoding transcript Het
Gm10985 CTCTAT CT 3: 53,845,249 probably null Het
Gprc5b G T 7: 118,984,175 P157Q probably damaging Het
Gsdmc3 G A 15: 63,858,534 Q394* probably null Het
Gucd1 A G 10: 75,512,088 S38P probably damaging Het
Higd1a A T 9: 121,850,247 I58N probably damaging Het
Hmx3 G C 7: 131,544,549 V329L possibly damaging Het
Hnrnpul2 A T 19: 8,824,438 R337* probably null Het
Idua T A 5: 108,681,438 H368Q possibly damaging Het
Ifih1 A G 2: 62,623,467 V218A probably benign Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Klhl30 T A 1: 91,358,777 probably null Het
Lasp1 T A 11: 97,836,134 D227E probably benign Het
Lhx6 A G 2: 36,091,324 I85T possibly damaging Het
Limch1 A G 5: 67,029,760 D840G probably damaging Het
Loxl4 C G 19: 42,603,963 E385D probably damaging Het
Lrrtm4 A T 6: 80,021,739 I44F probably damaging Het
Ltbp2 T C 12: 84,785,709 probably null Het
Lyg1 T C 1: 37,950,674 Y44C probably damaging Het
Maats1 T C 16: 38,341,762 T6A probably benign Het
Map1a A G 2: 121,298,641 I129V probably damaging Het
Med27 C T 2: 29,524,430 Q150* probably null Het
Ms4a5 A T 19: 11,279,368 I55N probably damaging Het
Muc5ac T C 7: 141,810,742 S2597P possibly damaging Het
Mxd1 A C 6: 86,651,440 probably null Het
Myo3a A G 2: 22,578,174 D480G probably benign Het
Neb T C 2: 52,310,638 Y343C probably damaging Het
Nrn1 A C 13: 36,730,206 V34G probably damaging Het
Olfr1090 A T 2: 86,754,452 N95K probably benign Het
Olfr1099 T C 2: 86,959,098 Y120C possibly damaging Het
Olfr1302 A G 2: 111,780,496 M59V probably damaging Het
Olfr679 A G 7: 105,086,615 T300A probably damaging Het
Olfr690 C T 7: 105,329,252 W313* probably null Het
Olfr722 A G 14: 49,895,067 I245T probably benign Het
Olfr887 G T 9: 38,085,276 V147L probably benign Het
Pdia4 A T 6: 47,796,837 V526E probably damaging Het
Pdia6 T C 12: 17,278,545 V167A probably damaging Het
Pgk2 A G 17: 40,207,509 F343L probably damaging Het
Piwil1 T C 5: 128,754,096 V827A probably damaging Het
Plag1 A T 4: 3,904,169 Y341N possibly damaging Het
Plch2 T C 4: 154,998,999 E393G probably damaging Het
Ptprg T A 14: 12,154,355 M692K probably benign Het
Rassf8 G A 6: 145,815,182 R78H probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpa2 T C 4: 132,768,788 probably null Het
Rpe T G 1: 66,715,980 F174V possibly damaging Het
Sbf2 T C 7: 110,560,295 D36G probably damaging Het
Scn2a T A 2: 65,752,079 Y1590* probably null Het
Slc24a4 T C 12: 102,222,759 V151A probably damaging Het
Slc30a8 A T 15: 52,295,934 M17L probably benign Het
Slit3 T C 11: 35,688,679 Y1228H probably damaging Het
Smad4 G A 18: 73,662,744 T193M probably benign Het
Smtn T A 11: 3,530,045 H392L probably benign Het
St8sia3 A G 18: 64,269,674 D128G probably damaging Het
Sucla2 A T 14: 73,592,668 M382L possibly damaging Het
Tbx5 A G 5: 119,836,923 T4A probably benign Het
Tdrd5 T C 1: 156,276,573 R528G probably damaging Het
Tex44 T C 1: 86,427,089 L240P probably benign Het
Tns4 A T 11: 99,080,078 probably null Het
Trappc10 A T 10: 78,203,924 V731E possibly damaging Het
Ttf1 A G 2: 29,071,345 K582E probably damaging Het
Ttf2 C A 3: 100,948,193 Q895H possibly damaging Het
Ttll6 A G 11: 96,147,532 E402G probably damaging Het
Ttn A T 2: 76,890,092 probably null Het
Ugt8a T C 3: 125,875,546 D303G probably damaging Het
Ulk1 G T 5: 110,792,436 A373D probably benign Het
Vmn2r13 A G 5: 109,158,192 S507P probably benign Het
Vmn2r19 T A 6: 123,316,074 D358E possibly damaging Het
Vmn2r88 T C 14: 51,413,807 S201P probably benign Het
Zfp36l2 A G 17: 84,186,975 F78S probably damaging Het
Zfp454 A C 11: 50,873,995 S203R probably benign Het
Zfp616 C A 11: 74,085,403 Q833K probably benign Het
Znhit2 A G 19: 6,062,061 T279A probably benign Het
Zswim3 T A 2: 164,819,993 I131N probably benign Het
Other mutations in Rnf213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rnf213 APN 11 119449343 missense probably benign 0.00
IGL00961:Rnf213 APN 11 119440843 missense possibly damaging 0.55
IGL01324:Rnf213 APN 11 119447237 missense probably damaging 1.00
IGL01351:Rnf213 APN 11 119483118 missense probably benign 0.25
IGL01403:Rnf213 APN 11 119443300 missense probably damaging 1.00
IGL01704:Rnf213 APN 11 119449876 critical splice donor site probably null
IGL01765:Rnf213 APN 11 119436352 missense probably benign 0.00
IGL01803:Rnf213 APN 11 119441307 missense probably damaging 1.00
IGL01804:Rnf213 APN 11 119442266 missense probably damaging 1.00
IGL01900:Rnf213 APN 11 119443015 missense probably benign 0.05
IGL01944:Rnf213 APN 11 119416457 missense probably benign 0.01
IGL01982:Rnf213 APN 11 119443268 missense probably damaging 1.00
IGL02008:Rnf213 APN 11 119418309 splice site probably benign
IGL02084:Rnf213 APN 11 119445673 missense probably benign 0.04
IGL02253:Rnf213 APN 11 119440650 missense probably benign 0.03
IGL02254:Rnf213 APN 11 119480907 missense possibly damaging 0.89
IGL02296:Rnf213 APN 11 119463336 missense probably benign 0.01
IGL02531:Rnf213 APN 11 119436802 missense probably benign
IGL02588:Rnf213 APN 11 119416536 missense probably benign 0.30
IGL02615:Rnf213 APN 11 119440789 missense probably damaging 0.96
IGL02805:Rnf213 APN 11 119435066 missense probably damaging 0.99
IGL02887:Rnf213 APN 11 119427510 missense probably damaging 1.00
IGL03001:Rnf213 APN 11 119479941 missense probably damaging 1.00
IGL03035:Rnf213 APN 11 119445626 splice site probably benign
IGL03057:Rnf213 APN 11 119441087 missense probably damaging 1.00
IGL03148:Rnf213 APN 11 119465007 missense probably damaging 1.00
IGL03308:Rnf213 APN 11 119474172 missense probably benign 0.03
IGL03339:Rnf213 APN 11 119443004 missense probably damaging 1.00
IGL03369:Rnf213 APN 11 119421468 missense probably benign 0.34
attrition UTSW 11 119430321 missense possibly damaging 0.77
dinky UTSW 11 119416458 missense probably damaging 0.99
B6584:Rnf213 UTSW 11 119426069 missense probably damaging 0.97
PIT4585001:Rnf213 UTSW 11 119458392 missense
R0008:Rnf213 UTSW 11 119465052 missense possibly damaging 0.82
R0015:Rnf213 UTSW 11 119441606 missense possibly damaging 0.95
R0041:Rnf213 UTSW 11 119402575 missense probably benign 0.41
R0114:Rnf213 UTSW 11 119414587 missense probably damaging 1.00
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0132:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0138:Rnf213 UTSW 11 119416496 missense probably benign 0.05
R0144:Rnf213 UTSW 11 119479600 nonsense probably null
R0184:Rnf213 UTSW 11 119414521 missense probably damaging 0.99
R0321:Rnf213 UTSW 11 119438105 nonsense probably null
R0365:Rnf213 UTSW 11 119426111 missense possibly damaging 0.74
R0415:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
R0421:Rnf213 UTSW 11 119447257 missense probably damaging 1.00
R0494:Rnf213 UTSW 11 119426012 missense possibly damaging 0.65
R0494:Rnf213 UTSW 11 119443120 missense probably damaging 1.00
R0549:Rnf213 UTSW 11 119465082 missense probably damaging 1.00
R0577:Rnf213 UTSW 11 119443280 missense probably damaging 1.00
R0605:Rnf213 UTSW 11 119431717 missense probably benign 0.03
R0638:Rnf213 UTSW 11 119470210 missense probably damaging 1.00
R0675:Rnf213 UTSW 11 119441834 missense probably benign 0.28
R0715:Rnf213 UTSW 11 119441150 missense probably damaging 0.97
R0732:Rnf213 UTSW 11 119441068 missense probably damaging 0.99
R0748:Rnf213 UTSW 11 119473480 missense probably damaging 1.00
R0765:Rnf213 UTSW 11 119423095 critical splice donor site probably null
R0890:Rnf213 UTSW 11 119430486 missense possibly damaging 0.94
R0927:Rnf213 UTSW 11 119414570 missense probably benign 0.00
R0940:Rnf213 UTSW 11 119416563 missense probably benign 0.10
R0959:Rnf213 UTSW 11 119452581 missense probably damaging 0.99
R1077:Rnf213 UTSW 11 119485998 splice site probably benign
R1104:Rnf213 UTSW 11 119477229 missense probably benign 0.29
R1141:Rnf213 UTSW 11 119435983 missense probably benign 0.02
R1219:Rnf213 UTSW 11 119436177 missense probably damaging 1.00
R1435:Rnf213 UTSW 11 119436005 missense probably damaging 1.00
R1444:Rnf213 UTSW 11 119442400 missense probably damaging 1.00
R1474:Rnf213 UTSW 11 119437750 missense probably damaging 1.00
R1488:Rnf213 UTSW 11 119480889 missense probably benign 0.05
R1523:Rnf213 UTSW 11 119441888 missense probably damaging 1.00
R1548:Rnf213 UTSW 11 119442707 missense probably damaging 1.00
R1554:Rnf213 UTSW 11 119441839 missense probably benign 0.06
R1563:Rnf213 UTSW 11 119414526 missense probably benign 0.13
R1572:Rnf213 UTSW 11 119436611 missense probably damaging 1.00
R1585:Rnf213 UTSW 11 119463345 missense probably damaging 1.00
R1635:Rnf213 UTSW 11 119442579 missense probably damaging 0.97
R1663:Rnf213 UTSW 11 119437672 missense probably benign 0.01
R1789:Rnf213 UTSW 11 119440221 missense probably damaging 0.97
R1844:Rnf213 UTSW 11 119441183 missense probably damaging 1.00
R1871:Rnf213 UTSW 11 119450129 missense probably benign 0.08
R1893:Rnf213 UTSW 11 119416448 missense probably damaging 1.00
R1937:Rnf213 UTSW 11 119431685 missense probably damaging 1.00
R1967:Rnf213 UTSW 11 119480895 missense probably damaging 1.00
R1987:Rnf213 UTSW 11 119441107 missense probably damaging 1.00
R2000:Rnf213 UTSW 11 119436022 missense probably damaging 1.00
R2020:Rnf213 UTSW 11 119461918 missense probably damaging 0.99
R2100:Rnf213 UTSW 11 119467302 nonsense probably null
R2109:Rnf213 UTSW 11 119442663 nonsense probably null
R2115:Rnf213 UTSW 11 119428013 missense probably benign 0.00
R2144:Rnf213 UTSW 11 119443690 missense probably damaging 0.99
R2145:Rnf213 UTSW 11 119415193 missense probably benign 0.03
R2168:Rnf213 UTSW 11 119415070 missense probably damaging 0.97
R2189:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R2199:Rnf213 UTSW 11 119460009 missense probably benign 0.01
R2220:Rnf213 UTSW 11 119436428 missense possibly damaging 0.94
R2336:Rnf213 UTSW 11 119414604 missense probably benign 0.02
R2400:Rnf213 UTSW 11 119443195 missense probably damaging 1.00
R2679:Rnf213 UTSW 11 119459938 splice site probably null
R2698:Rnf213 UTSW 11 119410144 missense probably benign 0.26
R3151:Rnf213 UTSW 11 119468892 missense probably benign 0.03
R3607:Rnf213 UTSW 11 119441976 nonsense probably null
R3808:Rnf213 UTSW 11 119479558 missense probably damaging 1.00
R3854:Rnf213 UTSW 11 119480939 splice site probably benign
R3856:Rnf213 UTSW 11 119480939 splice site probably benign
R3973:Rnf213 UTSW 11 119469053 missense probably benign 0.27
R4014:Rnf213 UTSW 11 119445729 nonsense probably null
R4049:Rnf213 UTSW 11 119482448 missense possibly damaging 0.67
R4130:Rnf213 UTSW 11 119483006 missense probably damaging 1.00
R4153:Rnf213 UTSW 11 119409482 missense probably benign 0.27
R4167:Rnf213 UTSW 11 119441243 missense probably damaging 0.99
R4224:Rnf213 UTSW 11 119436823 nonsense probably null
R4332:Rnf213 UTSW 11 119436676 missense probably damaging 1.00
R4415:Rnf213 UTSW 11 119483964 missense probably damaging 0.99
R4547:Rnf213 UTSW 11 119479670 critical splice donor site probably null
R4609:Rnf213 UTSW 11 119437695 missense possibly damaging 0.86
R4684:Rnf213 UTSW 11 119441125 missense probably damaging 1.00
R4704:Rnf213 UTSW 11 119440349 missense probably damaging 1.00
R4719:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R4751:Rnf213 UTSW 11 119445745 missense probably benign 0.12
R4828:Rnf213 UTSW 11 119416629 missense possibly damaging 0.61
R4837:Rnf213 UTSW 11 119442763 missense probably benign 0.00
R4894:Rnf213 UTSW 11 119481240 missense probably damaging 1.00
R4973:Rnf213 UTSW 11 119428157 missense possibly damaging 0.84
R5026:Rnf213 UTSW 11 119436764 missense probably damaging 1.00
R5034:Rnf213 UTSW 11 119410807 missense probably damaging 0.99
R5284:Rnf213 UTSW 11 119458866 missense possibly damaging 0.89
R5295:Rnf213 UTSW 11 119440816 missense probably benign 0.00
R5406:Rnf213 UTSW 11 119440808 missense probably damaging 1.00
R5441:Rnf213 UTSW 11 119409020 missense probably damaging 0.99
R5449:Rnf213 UTSW 11 119415076 missense probably benign 0.44
R5520:Rnf213 UTSW 11 119433499 missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119436629 missense probably benign 0.04
R5636:Rnf213 UTSW 11 119436905 missense probably damaging 1.00
R5669:Rnf213 UTSW 11 119458785 missense possibly damaging 0.92
R5670:Rnf213 UTSW 11 119434686 critical splice acceptor site probably null
R5697:Rnf213 UTSW 11 119483894 missense possibly damaging 0.54
R5726:Rnf213 UTSW 11 119416458 missense probably damaging 0.99
R5808:Rnf213 UTSW 11 119436295 missense probably benign
R5861:Rnf213 UTSW 11 119473377 missense probably damaging 1.00
R5903:Rnf213 UTSW 11 119421369 missense probably damaging 0.98
R5949:Rnf213 UTSW 11 119443079 missense probably damaging 1.00
R6022:Rnf213 UTSW 11 119486010 missense probably benign 0.00
R6043:Rnf213 UTSW 11 119442101 missense probably damaging 0.97
R6089:Rnf213 UTSW 11 119416559 missense probably benign 0.14
R6123:Rnf213 UTSW 11 119411513 missense probably damaging 0.96
R6134:Rnf213 UTSW 11 119411470 missense probably damaging 0.99
R6135:Rnf213 UTSW 11 119442028 missense probably benign 0.02
R6146:Rnf213 UTSW 11 119435999 missense probably benign 0.41
R6163:Rnf213 UTSW 11 119458428 missense possibly damaging 0.86
R6272:Rnf213 UTSW 11 119414548 missense probably damaging 1.00
R6333:Rnf213 UTSW 11 119463366 missense probably damaging 1.00
R6370:Rnf213 UTSW 11 119477078 missense probably damaging 0.99
R6456:Rnf213 UTSW 11 119459966 missense probably benign 0.03
R6468:Rnf213 UTSW 11 119452687 missense possibly damaging 0.94
R6579:Rnf213 UTSW 11 119436280 missense probably damaging 0.96
R6648:Rnf213 UTSW 11 119479920 missense possibly damaging 0.81
R6727:Rnf213 UTSW 11 119430321 missense possibly damaging 0.77
R6739:Rnf213 UTSW 11 119442271 missense probably damaging 1.00
R6768:Rnf213 UTSW 11 119442236 missense probably damaging 0.99
R6817:Rnf213 UTSW 11 119462285 critical splice donor site probably null
R6820:Rnf213 UTSW 11 119448838 missense probably damaging 1.00
R6841:Rnf213 UTSW 11 119449866 missense probably benign 0.26
R6934:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R7026:Rnf213 UTSW 11 119479655 missense possibly damaging 0.58
S24628:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
X0021:Rnf213 UTSW 11 119441824 missense probably benign 0.14
X0062:Rnf213 UTSW 11 119473513 missense probably benign 0.05
X0064:Rnf213 UTSW 11 119440463 missense probably damaging 1.00
Z1088:Rnf213 UTSW 11 119477254 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AAACTTGCCTGGCCAAAGGG -3'
(R):5'- AGATGAGTCCCACCAACAGGAG -3'

Sequencing Primer
(F):5'- CAAAGGGTGAGCGGTTTCCTC -3'
(R):5'- GGAGCCCATCACTAACAGTAAC -3'
Posted On2014-09-17