Incidental Mutation 'R2119:Heatr1'
ID231312
Institutional Source Beutler Lab
Gene Symbol Heatr1
Ensembl Gene ENSMUSG00000050244
Gene NameHEAT repeat containing 1
SynonymsB130016L12Rik
MMRRC Submission 040123-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R2119 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location12395027-12440289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12432646 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1740 (L1740Q)
Ref Sequence ENSEMBL: ENSMUSP00000054084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059270]
Predicted Effect probably null
Transcript: ENSMUST00000059270
AA Change: L1740Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: L1740Q

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:U3snoRNP10 238 354 7e-30 PFAM
SCOP:d1qbkb_ 919 1795 3e-8 SMART
low complexity region 1805 1814 N/A INTRINSIC
BP28CT 1856 2009 2.25e-77 SMART
Blast:BP28CT 2015 2061 2e-15 BLAST
coiled coil region 2109 2137 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221616
Predicted Effect probably damaging
Transcript: ENSMUST00000222091
AA Change: L340Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Actbl2 G A 13: 111,255,160 V10I probably benign Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Aifm2 G A 10: 61,735,604 V306M possibly damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Atxn7l3 C A 11: 102,291,981 R278L possibly damaging Het
Bcl9 A G 3: 97,208,915 L821P probably benign Het
Cdh19 C T 1: 110,919,590 V430I probably benign Het
Clns1a T A 7: 97,713,904 probably null Het
Col3a1 T A 1: 45,346,121 C133S probably damaging Het
Csmd1 G A 8: 17,216,733 T59I probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Cyp2j8 A T 4: 96,507,201 D62E probably benign Het
Dcbld1 A T 10: 52,319,979 M428L probably benign Het
Dhx32 A T 7: 133,722,247 Y523* probably null Het
Dlgap2 C T 8: 14,778,206 A538V possibly damaging Het
Dlgap3 T C 4: 127,236,189 S919P probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dsc1 A T 18: 20,110,152 H81Q probably benign Het
Dusp8 A T 7: 142,082,561 S431T possibly damaging Het
Dync1i1 A T 6: 5,767,096 T59S probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Eef1d G T 15: 75,903,213 A199E probably benign Het
Eml3 T A 19: 8,934,354 probably null Het
Enah G T 1: 181,921,753 A138E probably damaging Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Gba A T 3: 89,205,561 E170V probably benign Het
Hdac1 C T 4: 129,522,364 R212Q probably benign Het
Inhbb T A 1: 119,420,701 H129L probably benign Het
Inpp5b T A 4: 124,797,869 H862Q probably benign Het
Itsn2 C A 12: 4,707,025 R1372S probably benign Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Klk1b21 A T 7: 44,105,769 T163S probably benign Het
Lmo3 A T 6: 138,416,494 C43S probably damaging Het
Metrn C T 17: 25,795,223 V210I probably benign Het
Ndufaf7 A T 17: 78,945,013 I284F possibly damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr713 A G 7: 107,036,731 D192G probably damaging Het
Osbpl7 T C 11: 97,056,079 S403P probably benign Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reln T A 5: 22,019,000 E917V probably damaging Het
Rfc4 A T 16: 23,124,564 V61E probably damaging Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Rtn4ip1 A G 10: 43,935,997 probably null Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Serhl A G 15: 83,115,575 Q252R probably benign Het
Sestd1 T C 2: 77,212,523 D229G probably benign Het
Slc35g1 T C 19: 38,403,287 V339A probably benign Het
Slc9b2 T A 3: 135,328,982 probably null Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tep1 T G 14: 50,838,986 K1664Q probably benign Het
Tmod2 T C 9: 75,586,095 K193E possibly damaging Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Ttc5 A T 14: 50,775,365 Y189N probably damaging Het
Ugt2a3 A T 5: 87,336,571 M198K probably damaging Het
Uox A G 3: 146,612,542 H66R probably benign Het
Usp9y A T Y: 1,303,451 D2487E probably benign Het
Vnn3 G A 10: 23,864,413 G205R probably damaging Het
Vps11 T C 9: 44,348,997 D856G probably benign Het
Zdhhc17 T C 10: 110,982,048 N90D possibly damaging Het
Zfp105 T A 9: 122,929,678 L138* probably null Het
Zfp28 A G 7: 6,394,876 Y770C probably benign Het
Zfp655 T A 5: 145,244,784 L484Q probably damaging Het
Zfp868 C A 8: 69,611,995 E230* probably null Het
Zfpm2 A G 15: 41,103,023 Y836C probably damaging Het
Other mutations in Heatr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Heatr1 APN 13 12410450 missense probably benign 0.00
IGL00863:Heatr1 APN 13 12435128 missense probably benign 0.02
IGL00899:Heatr1 APN 13 12435176 missense probably benign 0.31
IGL01147:Heatr1 APN 13 12437912 missense probably damaging 0.99
IGL01317:Heatr1 APN 13 12399027 missense probably damaging 1.00
IGL01323:Heatr1 APN 13 12398938 missense possibly damaging 0.86
IGL01625:Heatr1 APN 13 12413528 missense probably damaging 0.98
IGL01973:Heatr1 APN 13 12429799 missense probably benign
IGL02803:Heatr1 APN 13 12433986 missense probably damaging 0.96
IGL02830:Heatr1 APN 13 12426212 missense possibly damaging 0.57
IGL02956:Heatr1 APN 13 12416059 missense possibly damaging 0.53
IGL03000:Heatr1 APN 13 12434411 missense probably damaging 0.99
IGL03024:Heatr1 APN 13 12407509 unclassified probably benign
IGL03035:Heatr1 APN 13 12413219 splice site probably benign
IGL03301:Heatr1 APN 13 12434205 missense probably damaging 1.00
hasan UTSW 13 12417447 splice site probably benign
H8562:Heatr1 UTSW 13 12408713 missense probably benign 0.13
R0226:Heatr1 UTSW 13 12410562 missense probably damaging 1.00
R0571:Heatr1 UTSW 13 12430240 missense probably damaging 0.98
R0722:Heatr1 UTSW 13 12406037 missense probably benign 0.14
R1264:Heatr1 UTSW 13 12424610 unclassified probably benign
R1371:Heatr1 UTSW 13 12417632 missense possibly damaging 0.80
R1388:Heatr1 UTSW 13 12417447 splice site probably benign
R1396:Heatr1 UTSW 13 12406046 missense possibly damaging 0.86
R1519:Heatr1 UTSW 13 12412159 missense probably benign
R1689:Heatr1 UTSW 13 12424625 missense probably benign 0.00
R1696:Heatr1 UTSW 13 12423721 missense possibly damaging 0.96
R1756:Heatr1 UTSW 13 12396460 missense probably benign 0.01
R1859:Heatr1 UTSW 13 12403159 missense probably damaging 1.00
R1932:Heatr1 UTSW 13 12435185 missense probably damaging 1.00
R1957:Heatr1 UTSW 13 12396538 missense probably damaging 1.00
R2018:Heatr1 UTSW 13 12414478 missense possibly damaging 0.68
R2106:Heatr1 UTSW 13 12412058 missense probably benign 0.03
R2121:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2122:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2367:Heatr1 UTSW 13 12433724 missense probably damaging 1.00
R3777:Heatr1 UTSW 13 12413348 missense possibly damaging 0.92
R3783:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3784:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3786:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3787:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3843:Heatr1 UTSW 13 12435121 missense probably benign 0.00
R4533:Heatr1 UTSW 13 12434511 missense probably benign 0.05
R4725:Heatr1 UTSW 13 12424662 nonsense probably null
R4763:Heatr1 UTSW 13 12430930 missense possibly damaging 0.65
R4793:Heatr1 UTSW 13 12431837 missense probably benign 0.00
R4797:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4798:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4942:Heatr1 UTSW 13 12413510 critical splice acceptor site probably null
R4952:Heatr1 UTSW 13 12410599 missense probably benign 0.38
R4954:Heatr1 UTSW 13 12407516 critical splice acceptor site probably null
R5370:Heatr1 UTSW 13 12401522 missense probably benign 0.02
R5464:Heatr1 UTSW 13 12433643 missense probably benign 0.00
R5483:Heatr1 UTSW 13 12398914 missense probably damaging 1.00
R5497:Heatr1 UTSW 13 12421064 missense possibly damaging 0.93
R5504:Heatr1 UTSW 13 12406619 missense possibly damaging 0.64
R5527:Heatr1 UTSW 13 12402760 missense probably damaging 1.00
R5527:Heatr1 UTSW 13 12404948 missense probably benign
R5836:Heatr1 UTSW 13 12408736 missense probably damaging 0.99
R5916:Heatr1 UTSW 13 12434471 missense probably damaging 1.00
R6018:Heatr1 UTSW 13 12404947 missense probably benign
R6018:Heatr1 UTSW 13 12406058 missense probably benign 0.26
R6216:Heatr1 UTSW 13 12432664 missense probably benign 0.16
R6396:Heatr1 UTSW 13 12406097 missense possibly damaging 0.86
R6472:Heatr1 UTSW 13 12434230 missense probably benign 0.29
R6922:Heatr1 UTSW 13 12435075 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGCACTGTTGGCACCAAG -3'
(R):5'- GACTGAGGGGTGAAACTGTC -3'

Sequencing Primer
(F):5'- GCATACTGTGGGTTACAG -3'
(R):5'- TGAAACTGTCCCCCTGGC -3'
Posted On2014-09-18