Incidental Mutation 'R2137:Rcbtb2'
ID235910
Institutional Source Beutler Lab
Gene Symbol Rcbtb2
Ensembl Gene ENSMUSG00000022106
Gene Nameregulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2
SynonymsRc/btb2, Chc1l, 2610028E02Rik, 2810420M18Rik
MMRRC Submission 040140-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R2137 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location73123037-73207843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73162051 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 52 (G52S)
Ref Sequence ENSEMBL: ENSMUSP00000130732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022702] [ENSMUST00000110952] [ENSMUST00000163339] [ENSMUST00000163533] [ENSMUST00000163797] [ENSMUST00000164298] [ENSMUST00000164822] [ENSMUST00000165429] [ENSMUST00000165567] [ENSMUST00000165727] [ENSMUST00000167021] [ENSMUST00000167401] [ENSMUST00000169479] [ENSMUST00000169513] [ENSMUST00000170368] [ENSMUST00000170370] [ENSMUST00000170677] [ENSMUST00000171070] [ENSMUST00000171767]
Predicted Effect probably damaging
Transcript: ENSMUST00000022702
AA Change: G52S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022702
Gene: ENSMUSG00000022106
AA Change: G52S

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.1e-16 PFAM
Pfam:RCC1_2 154 183 7.1e-15 PFAM
Pfam:RCC1 170 220 1.7e-14 PFAM
Pfam:RCC1 223 272 7.1e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-12 PFAM
Pfam:RCC1 275 324 8e-16 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110952
AA Change: G52S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106577
Gene: ENSMUSG00000022106
AA Change: G52S

DomainStartEndE-ValueType
Pfam:RCC1 117 167 3e-16 PFAM
Pfam:RCC1_2 154 183 7.8e-15 PFAM
Pfam:RCC1 170 220 1.4e-15 PFAM
Pfam:RCC1 223 272 9.4e-18 PFAM
Pfam:RCC1_2 259 288 2.6e-11 PFAM
Pfam:RCC1 275 324 1.2e-13 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163339
Predicted Effect probably damaging
Transcript: ENSMUST00000163533
AA Change: G52S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130828
Gene: ENSMUSG00000022106
AA Change: G52S

DomainStartEndE-ValueType
Pfam:RCC1 117 150 4.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163797
AA Change: G38S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132125
Gene: ENSMUSG00000022106
AA Change: G38S

DomainStartEndE-ValueType
Pfam:RCC1 136 174 7.7e-12 PFAM
low complexity region 199 207 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164298
AA Change: G38S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126651
Gene: ENSMUSG00000022106
AA Change: G38S

DomainStartEndE-ValueType
Pfam:RCC1 103 153 2.9e-17 PFAM
Pfam:RCC1_2 140 169 2.2e-15 PFAM
Pfam:RCC1 156 206 4.4e-15 PFAM
Pfam:RCC1 209 247 1.2e-11 PFAM
low complexity region 272 280 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164822
AA Change: G52S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131588
Gene: ENSMUSG00000022106
AA Change: G52S

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.1e-16 PFAM
Pfam:RCC1_2 154 183 7.1e-15 PFAM
Pfam:RCC1 170 220 1.7e-14 PFAM
Pfam:RCC1 223 272 7.1e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-12 PFAM
Pfam:RCC1 275 324 8e-16 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165429
AA Change: G28S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127258
Gene: ENSMUSG00000022106
AA Change: G28S

DomainStartEndE-ValueType
Pfam:RCC1 93 143 4.4e-17 PFAM
Pfam:RCC1_2 130 157 5.2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165567
AA Change: G52S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130240
Gene: ENSMUSG00000022106
AA Change: G52S

DomainStartEndE-ValueType
Pfam:RCC1 117 167 5.3e-17 PFAM
Pfam:RCC1_2 154 172 6.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165727
SMART Domains Protein: ENSMUSP00000128479
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
Pfam:RCC1 11 60 2.3e-14 PFAM
Pfam:RCC1 63 90 6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167021
Predicted Effect probably damaging
Transcript: ENSMUST00000167401
AA Change: G52S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000169479
AA Change: G52S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126898
Gene: ENSMUSG00000022106
AA Change: G52S

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.1e-16 PFAM
Pfam:RCC1_2 154 183 7.1e-15 PFAM
Pfam:RCC1 170 220 1.7e-14 PFAM
Pfam:RCC1 223 272 7.1e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-12 PFAM
Pfam:RCC1 275 324 8e-16 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169513
AA Change: G28S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128579
Gene: ENSMUSG00000022106
AA Change: G28S

DomainStartEndE-ValueType
Pfam:RCC1 93 143 3.1e-16 PFAM
Pfam:RCC1_2 130 159 1.9e-14 PFAM
Pfam:RCC1 146 196 4.7e-14 PFAM
Pfam:RCC1 199 248 1.9e-17 PFAM
Pfam:RCC1_2 235 264 4.4e-12 PFAM
Pfam:RCC1 251 300 2.2e-15 PFAM
BTB 370 463 2.69e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170368
AA Change: G52S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126276
Gene: ENSMUSG00000022106
AA Change: G52S

DomainStartEndE-ValueType
SCOP:d1a12a_ 45 86 9e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170370
AA Change: G52S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130732
Gene: ENSMUSG00000022106
AA Change: G52S

DomainStartEndE-ValueType
SCOP:d1a12a_ 45 128 1e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170677
AA Change: G28S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126510
Gene: ENSMUSG00000022106
AA Change: G28S

DomainStartEndE-ValueType
Pfam:RCC1 93 143 3.1e-16 PFAM
Pfam:RCC1_2 130 159 1.9e-14 PFAM
Pfam:RCC1 146 196 4.7e-14 PFAM
Pfam:RCC1 199 248 1.9e-17 PFAM
Pfam:RCC1_2 235 264 4.4e-12 PFAM
Pfam:RCC1 251 300 2.2e-15 PFAM
BTB 370 463 2.69e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171070
AA Change: G52S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171163
Predicted Effect probably damaging
Transcript: ENSMUST00000171767
AA Change: G52S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127397
Gene: ENSMUSG00000022106
AA Change: G52S

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.7e-16 PFAM
Pfam:RCC1_2 154 183 4.9e-15 PFAM
Pfam:RCC1 170 220 8.4e-16 PFAM
Pfam:RCC1 223 272 5.5e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-11 PFAM
Pfam:RCC1 275 324 6.8e-14 PFAM
BTB 394 487 2.69e-21 SMART
Meta Mutation Damage Score 0.434 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two C-terminal BTB/POZ domains that is related to regulator of chromosome condensation (RCC). The encoded protein may act as a guanine nucleotide exchange factor. This gene is observed to be lost or underexpressed in prostate cancers. There is a pseudogene of this gene on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd24 C T 10: 81,646,309 T88I probably damaging Het
Atm A T 9: 53,453,375 V49D probably damaging Het
Bub1b G T 2: 118,636,718 E841* probably null Het
Ccdc129 A G 6: 55,889,189 Q189R probably damaging Het
Cdh22 G A 2: 165,116,394 probably benign Het
Cdh7 A T 1: 110,100,106 N527I probably damaging Het
Cog1 T C 11: 113,659,301 L262P probably damaging Het
Col22a1 T C 15: 72,006,948 H120R possibly damaging Het
Col4a2 T C 8: 11,433,749 S890P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Evpl T C 11: 116,221,839 E1675G probably damaging Het
Faiml G A 9: 99,232,492 P115S probably benign Het
Fgg A T 3: 83,008,438 D62V possibly damaging Het
Gak C T 5: 108,606,877 probably null Het
Galntl6 C T 8: 58,535,905 probably null Het
Glyr1 T C 16: 5,018,482 Y501C probably benign Het
Gm9847 G T 12: 14,495,081 noncoding transcript Het
Gria4 T G 9: 4,427,026 probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il6st C A 13: 112,502,858 H606N possibly damaging Het
Kctd10 A G 5: 114,367,328 F202L probably damaging Het
Kif17 T A 4: 138,262,667 D55E probably damaging Het
Klf1 C T 8: 84,903,146 A200V possibly damaging Het
Klhl32 A T 4: 24,629,275 Y497* probably null Het
Kng2 G T 16: 22,997,326 probably benign Het
Lats1 T C 10: 7,701,847 V245A possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Mss51 T C 14: 20,487,523 I47V probably benign Het
Myoz2 G A 3: 123,034,212 T19M probably benign Het
Nampt T A 12: 32,830,310 N67K probably benign Het
Ncor2 A T 5: 125,030,712 I1607K probably damaging Het
Nudt4 T C 10: 95,563,738 Q7R probably damaging Het
Olfr1475 A G 19: 13,479,809 Y130H probably damaging Het
Olfr1480 T A 19: 13,530,438 I255N probably damaging Het
Olfr870 T A 9: 20,171,167 I135F probably damaging Het
Pgm1 A T 5: 64,116,366 M565L probably benign Het
Phactr1 T G 13: 43,135,175 F639V possibly damaging Het
Plod3 C A 5: 136,988,717 R165S probably damaging Het
Polr2b T A 5: 77,320,346 N164K probably benign Het
Rfc1 A G 5: 65,311,039 probably null Het
Rheb A G 5: 24,807,603 probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor2 G A 13: 24,721,834 probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scg3 A T 9: 75,676,810 D136E probably damaging Het
Slc10a4 C T 5: 73,007,580 L172F probably damaging Het
Slc35c2 A G 2: 165,281,379 Y113H probably damaging Het
Slc47a1 T A 11: 61,344,492 D505V probably benign Het
Snap29 C A 16: 17,428,249 D244E possibly damaging Het
Taar1 T C 10: 23,921,270 F289L probably benign Het
Thbs2 T A 17: 14,673,306 N871Y probably damaging Het
Tmem108 T A 9: 103,499,963 T96S possibly damaging Het
Tnk2 G T 16: 32,670,802 probably null Het
Trak1 T A 9: 121,472,962 M928K possibly damaging Het
Tuba3b A G 6: 145,618,833 I110V probably benign Het
Tyk2 A G 9: 21,110,985 probably benign Het
Ugt1a9 T A 1: 88,071,037 C70S probably benign Het
Vmn2r10 A T 5: 109,003,544 I68K possibly damaging Het
Wfs1 T C 5: 36,967,501 E682G probably damaging Het
Zfp213 T C 17: 23,559,507 probably null Het
Zfp809 T C 9: 22,235,138 V41A probably benign Het
Zfp831 A G 2: 174,705,746 K1574R possibly damaging Het
Other mutations in Rcbtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Rcbtb2 APN 14 73164782 missense possibly damaging 0.94
IGL02550:Rcbtb2 APN 14 73162019 missense probably damaging 1.00
IGL02800:Rcbtb2 APN 14 73168103 nonsense probably null
IGL02811:Rcbtb2 APN 14 73174411 missense probably damaging 1.00
R0319:Rcbtb2 UTSW 14 73178469 missense probably benign 0.04
R0390:Rcbtb2 UTSW 14 73178547 missense probably damaging 0.96
R0448:Rcbtb2 UTSW 14 73178429 splice site probably benign
R1298:Rcbtb2 UTSW 14 73162388 missense probably damaging 0.99
R1567:Rcbtb2 UTSW 14 73162462 missense probably benign 0.07
R2014:Rcbtb2 UTSW 14 73174386 splice site probably benign
R2218:Rcbtb2 UTSW 14 73178565 critical splice donor site probably null
R4505:Rcbtb2 UTSW 14 73173905 missense probably damaging 1.00
R5832:Rcbtb2 UTSW 14 73166822 missense possibly damaging 0.95
R5898:Rcbtb2 UTSW 14 73161965 nonsense probably null
R6484:Rcbtb2 UTSW 14 73177050 missense probably damaging 0.99
R7252:Rcbtb2 UTSW 14 73166780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGCCAGGTTAATGACTCTG -3'
(R):5'- AGCAAACTGCCTCGTCACAG -3'

Sequencing Primer
(F):5'- CCAGGTTAATGACTCTGGAGAAAC -3'
(R):5'- AGTTTCCCTGGATGTCTTC -3'
Posted On2014-10-01