Incidental Mutation 'R2137:Taar1'
ID235898
Institutional Source Beutler Lab
Gene Symbol Taar1
Ensembl Gene ENSMUSG00000056379
Gene Nametrace amine-associated receptor 1
SynonymsTrar1, Tar1
MMRRC Submission 040140-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R2137 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location23920356-23921469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23921270 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 289 (F289L)
Ref Sequence ENSEMBL: ENSMUSP00000049527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051532]
Predicted Effect probably benign
Transcript: ENSMUST00000051532
AA Change: F289L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049527
Gene: ENSMUSG00000056379
AA Change: F289L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 316 1.4e-11 PFAM
Pfam:7tm_1 39 301 2.4e-62 PFAM
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor activated by trace amines. The encoded protein responds little or not at all to dopamine, serotonin, epinephrine, or histamine, but responds well to beta-phenylethylamine, p-tyramine, octopamine, and tryptamine. While primarily functioning in neurologic systems, there is evidence that this gene is involved in blood cell and immunologic functions as well. This gene is thought to be intronless. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null mutation display decreased prepulse inhibition and increased sensitivity to amphetamines. Mice homozygous for another knock-out allele exhibit increased sensitivity to MDMA-induced hyperthermia, brain dopamine and serotonin levels, and induced hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd24 C T 10: 81,646,309 T88I probably damaging Het
Atm A T 9: 53,453,375 V49D probably damaging Het
Bub1b G T 2: 118,636,718 E841* probably null Het
Ccdc129 A G 6: 55,889,189 Q189R probably damaging Het
Cdh22 G A 2: 165,116,394 probably benign Het
Cdh7 A T 1: 110,100,106 N527I probably damaging Het
Cog1 T C 11: 113,659,301 L262P probably damaging Het
Col22a1 T C 15: 72,006,948 H120R possibly damaging Het
Col4a2 T C 8: 11,433,749 S890P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Evpl T C 11: 116,221,839 E1675G probably damaging Het
Faiml G A 9: 99,232,492 P115S probably benign Het
Fgg A T 3: 83,008,438 D62V possibly damaging Het
Gak C T 5: 108,606,877 probably null Het
Galntl6 C T 8: 58,535,905 probably null Het
Glyr1 T C 16: 5,018,482 Y501C probably benign Het
Gm9847 G T 12: 14,495,081 noncoding transcript Het
Gria4 T G 9: 4,427,026 probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il6st C A 13: 112,502,858 H606N possibly damaging Het
Kctd10 A G 5: 114,367,328 F202L probably damaging Het
Kif17 T A 4: 138,262,667 D55E probably damaging Het
Klf1 C T 8: 84,903,146 A200V possibly damaging Het
Klhl32 A T 4: 24,629,275 Y497* probably null Het
Kng2 G T 16: 22,997,326 probably benign Het
Lats1 T C 10: 7,701,847 V245A possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Mss51 T C 14: 20,487,523 I47V probably benign Het
Myoz2 G A 3: 123,034,212 T19M probably benign Het
Nampt T A 12: 32,830,310 N67K probably benign Het
Ncor2 A T 5: 125,030,712 I1607K probably damaging Het
Nudt4 T C 10: 95,563,738 Q7R probably damaging Het
Olfr1475 A G 19: 13,479,809 Y130H probably damaging Het
Olfr1480 T A 19: 13,530,438 I255N probably damaging Het
Olfr870 T A 9: 20,171,167 I135F probably damaging Het
Pgm1 A T 5: 64,116,366 M565L probably benign Het
Phactr1 T G 13: 43,135,175 F639V possibly damaging Het
Plod3 C A 5: 136,988,717 R165S probably damaging Het
Polr2b T A 5: 77,320,346 N164K probably benign Het
Rcbtb2 G A 14: 73,162,051 G52S probably damaging Het
Rfc1 A G 5: 65,311,039 probably null Het
Rheb A G 5: 24,807,603 probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor2 G A 13: 24,721,834 probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scg3 A T 9: 75,676,810 D136E probably damaging Het
Slc10a4 C T 5: 73,007,580 L172F probably damaging Het
Slc35c2 A G 2: 165,281,379 Y113H probably damaging Het
Slc47a1 T A 11: 61,344,492 D505V probably benign Het
Snap29 C A 16: 17,428,249 D244E possibly damaging Het
Thbs2 T A 17: 14,673,306 N871Y probably damaging Het
Tmem108 T A 9: 103,499,963 T96S possibly damaging Het
Tnk2 G T 16: 32,670,802 probably null Het
Trak1 T A 9: 121,472,962 M928K possibly damaging Het
Tuba3b A G 6: 145,618,833 I110V probably benign Het
Tyk2 A G 9: 21,110,985 probably benign Het
Ugt1a9 T A 1: 88,071,037 C70S probably benign Het
Vmn2r10 A T 5: 109,003,544 I68K possibly damaging Het
Wfs1 T C 5: 36,967,501 E682G probably damaging Het
Zfp213 T C 17: 23,559,507 probably null Het
Zfp809 T C 9: 22,235,138 V41A probably benign Het
Zfp831 A G 2: 174,705,746 K1574R possibly damaging Het
Other mutations in Taar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Taar1 APN 10 23920446 missense probably benign 0.00
R0022:Taar1 UTSW 10 23920727 missense probably benign 0.45
R0126:Taar1 UTSW 10 23920547 missense probably benign 0.00
R0442:Taar1 UTSW 10 23920482 missense possibly damaging 0.80
R0720:Taar1 UTSW 10 23921073 missense probably damaging 1.00
R0931:Taar1 UTSW 10 23921283 missense probably damaging 1.00
R1270:Taar1 UTSW 10 23920533 missense probably damaging 1.00
R1834:Taar1 UTSW 10 23921189 missense probably benign 0.04
R3765:Taar1 UTSW 10 23921307 missense probably damaging 1.00
R3873:Taar1 UTSW 10 23920584 missense probably damaging 1.00
R5334:Taar1 UTSW 10 23920545 missense probably damaging 1.00
R5418:Taar1 UTSW 10 23921316 missense possibly damaging 0.91
R5578:Taar1 UTSW 10 23920820 missense possibly damaging 0.71
R7048:Taar1 UTSW 10 23920824 missense probably benign 0.40
R7096:Taar1 UTSW 10 23920911 missense possibly damaging 0.48
R7163:Taar1 UTSW 10 23921020 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CGTACGAATGTTCAAGTTGGATTG -3'
(R):5'- TCTGTGCCTATAGTTGGCTCAC -3'

Sequencing Primer
(F):5'- CGAATGTTCAAGTTGGATTGGAAGG -3'
(R):5'- GAACAGTCAGTGCTCTTAGTCACTG -3'
Posted On2014-10-01