Incidental Mutation 'R2904:Kdm4b'
ID261601
Institutional Source Beutler Lab
Gene Symbol Kdm4b
Ensembl Gene ENSMUSG00000024201
Gene Namelysine (K)-specific demethylase 4B
SynonymsJmjd2b, 4732474L06Rik
MMRRC Submission 040491-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2904 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location56326062-56402870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56355884 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 152 (G152S)
Ref Sequence ENSEMBL: ENSMUSP00000025036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025036] [ENSMUST00000086835] [ENSMUST00000139679]
Predicted Effect probably benign
Transcript: ENSMUST00000025036
AA Change: G152S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000025036
Gene: ENSMUSG00000024201
AA Change: G152S

DomainStartEndE-ValueType
JmjN 14 56 5.88e-17 SMART
low complexity region 61 68 N/A INTRINSIC
JmjC 143 309 1.19e-59 SMART
low complexity region 349 361 N/A INTRINSIC
low complexity region 380 399 N/A INTRINSIC
low complexity region 443 449 N/A INTRINSIC
low complexity region 481 495 N/A INTRINSIC
low complexity region 511 537 N/A INTRINSIC
PHD 719 777 2.5e-5 SMART
PHD 839 895 7.07e-5 SMART
TUDOR 905 962 1.68e-9 SMART
TUDOR 963 1019 7.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086835
AA Change: G152S

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000084045
Gene: ENSMUSG00000024201
AA Change: G152S

DomainStartEndE-ValueType
JmjN 14 56 5.88e-17 SMART
low complexity region 61 68 N/A INTRINSIC
JmjC 143 309 1.19e-59 SMART
low complexity region 349 361 N/A INTRINSIC
low complexity region 380 399 N/A INTRINSIC
low complexity region 443 449 N/A INTRINSIC
low complexity region 481 495 N/A INTRINSIC
low complexity region 511 537 N/A INTRINSIC
PHD 712 770 2.5e-5 SMART
PHD 832 888 7.07e-5 SMART
TUDOR 898 954 2.31e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139679
AA Change: G152S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000118089
Gene: ENSMUSG00000024201
AA Change: G152S

DomainStartEndE-ValueType
JmjN 14 56 5.88e-17 SMART
low complexity region 61 68 N/A INTRINSIC
Pfam:JmjC 176 208 5.8e-13 PFAM
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (30/31)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele lacking demethylase activity exhibit no gross abnormalities. Mice homozygous for a conditional allele activated in mammary gland epithelial cells exhibit delayed mammary gland development with reduced branching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 T C 5: 100,809,807 E182G probably benign Het
Acot4 C G 12: 84,043,603 T358S probably benign Het
Ap2a2 A G 7: 141,619,478 K433E probably damaging Het
Card11 T A 5: 140,889,133 D592V probably benign Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Crisp1 C T 17: 40,313,004 probably null Het
Dzip1l A G 9: 99,663,669 E657G probably damaging Het
Fam208b T C 13: 3,582,185 N772S possibly damaging Het
Gak T C 5: 108,624,214 N79S possibly damaging Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Gmpr2 T C 14: 55,672,758 V15A probably damaging Het
Hectd4 T C 5: 121,292,724 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm6b G A 11: 69,405,785 T552I possibly damaging Het
Kdr T C 5: 75,966,409 Y307C probably damaging Het
Kif11 T C 19: 37,403,655 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd C T 2: 91,175,672 V20M probably damaging Het
Mkrn3 C A 7: 62,418,459 R528L probably benign Het
Myom2 T C 8: 15,098,348 V508A probably benign Het
Nav1 T C 1: 135,585,238 D28G probably benign Het
Nlrp4b T A 7: 10,714,367 W166R probably damaging Het
Olfr113 A T 17: 37,574,814 L203Q possibly damaging Het
Olfr483 T C 7: 108,103,599 Y97H probably benign Het
Rassf10 A T 7: 112,954,549 D119V possibly damaging Het
Smarcc1 A G 9: 110,173,975 N378D possibly damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Trim21 A G 7: 102,559,971 W282R probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Uggt2 T A 14: 119,059,109 Y447F possibly damaging Het
Zfp160 G A 17: 21,025,649 V154I probably benign Het
Other mutations in Kdm4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Kdm4b APN 17 56353019 missense probably benign 0.28
IGL01408:Kdm4b APN 17 56353518 splice site probably benign
IGL01610:Kdm4b APN 17 56353522 splice site probably benign
IGL01936:Kdm4b APN 17 56397355 missense probably damaging 1.00
IGL01964:Kdm4b APN 17 56389256 splice site probably null
IGL02151:Kdm4b APN 17 56396234 missense probably benign 0.05
IGL02596:Kdm4b APN 17 56399706 missense probably benign 0.14
IGL02975:Kdm4b APN 17 56375996 splice site probably null
IGL03172:Kdm4b APN 17 56401649 missense probably damaging 0.98
Coelestinum UTSW 17 56353091 missense probably benign 0.31
mistflower UTSW 17 56389564 missense possibly damaging 0.65
R0193:Kdm4b UTSW 17 56393952 missense probably benign 0.04
R0311:Kdm4b UTSW 17 56386200 missense probably benign 0.42
R0331:Kdm4b UTSW 17 56386289 splice site probably benign
R1109:Kdm4b UTSW 17 56399430 missense probably damaging 0.99
R1499:Kdm4b UTSW 17 56400025 missense probably damaging 1.00
R1895:Kdm4b UTSW 17 56397340 missense probably damaging 1.00
R1985:Kdm4b UTSW 17 56401302 missense probably damaging 1.00
R2087:Kdm4b UTSW 17 56389564 missense possibly damaging 0.65
R2185:Kdm4b UTSW 17 56393750 missense probably benign 0.00
R3792:Kdm4b UTSW 17 56355944 missense probably damaging 1.00
R3897:Kdm4b UTSW 17 56396955 missense probably damaging 1.00
R4661:Kdm4b UTSW 17 56399459 missense probably damaging 1.00
R4685:Kdm4b UTSW 17 56401675 missense probably benign 0.06
R4716:Kdm4b UTSW 17 56386178 missense probably benign 0.10
R4790:Kdm4b UTSW 17 56401618 missense probably damaging 0.97
R4864:Kdm4b UTSW 17 56353091 missense probably benign 0.31
R5700:Kdm4b UTSW 17 56351700 missense possibly damaging 0.93
R5963:Kdm4b UTSW 17 56399732 missense probably damaging 1.00
R6003:Kdm4b UTSW 17 56396916 missense probably damaging 1.00
R6029:Kdm4b UTSW 17 56396576 missense probably damaging 0.98
R6769:Kdm4b UTSW 17 56351754 missense possibly damaging 0.54
R6771:Kdm4b UTSW 17 56351754 missense possibly damaging 0.54
R6927:Kdm4b UTSW 17 56399435 missense probably damaging 1.00
X0024:Kdm4b UTSW 17 56401278 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCTAAGCAGCCCTAATGTG -3'
(R):5'- ATCAGGTCTTCCCATGGCTC -3'

Sequencing Primer
(F):5'- TAAGCAGCCCTAATGTGACCTTAGG -3'
(R):5'- TGGCACTCACCAGGACTTAG -3'
Posted On2015-01-23