Incidental Mutation 'R3820:Tmem8b'
ID274848
Institutional Source Beutler Lab
Gene Symbol Tmem8b
Ensembl Gene ENSMUSG00000078716
Gene Nametransmembrane protein 8B
Synonyms
MMRRC Submission 040882-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R3820 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43668971-43692668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43689745 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 800 (H800N)
Ref Sequence ENSEMBL: ENSMUSP00000103498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107864] [ENSMUST00000107865] [ENSMUST00000107866] [ENSMUST00000143339] [ENSMUST00000167153]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107864
AA Change: H341N

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103496
Gene: ENSMUSG00000078716
AA Change: H341N

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107865
AA Change: H341N

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103497
Gene: ENSMUSG00000078716
AA Change: H341N

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107866
AA Change: H800N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103498
Gene: ENSMUSG00000078716
AA Change: H800N

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 45 71 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
EGF 606 642 1.95e1 SMART
Pfam:DUF3522 652 836 1.4e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141864
Predicted Effect probably benign
Transcript: ENSMUST00000143339
SMART Domains Protein: ENSMUSP00000130133
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158322
Predicted Effect possibly damaging
Transcript: ENSMUST00000167153
AA Change: H341N

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129760
Gene: ENSMUSG00000078716
AA Change: H341N

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G T 18: 6,630,166 probably null Het
4932438A13Rik G A 3: 37,040,434 V917I probably damaging Het
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Adam6a T C 12: 113,544,178 I57T probably benign Het
Adam6b C T 12: 113,490,364 T267I probably benign Het
Ap1g2 G A 14: 55,100,573 probably benign Het
Arhgap22 G A 14: 33,367,421 E455K probably benign Het
Ccdc93 T C 1: 121,462,240 I253T probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Edar T C 10: 58,621,363 Y131C probably damaging Het
Eif5 A T 12: 111,540,184 R43* probably null Het
Eml4 C A 17: 83,473,065 T667K probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flt1 A G 5: 147,700,017 probably benign Het
Frem2 T A 3: 53,516,849 I3056F probably damaging Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Kcnma1 T C 14: 23,299,938 T1178A possibly damaging Het
Kcnt1 A G 2: 25,900,892 H486R probably damaging Het
Kif21a T C 15: 90,968,074 N950S probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Micall2 C T 5: 139,715,856 G461D possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Pds5a A G 5: 65,654,076 V338A possibly damaging Het
Pds5b T C 5: 150,736,337 V255A possibly damaging Het
Prkar2a T G 9: 108,746,956 F391V probably damaging Het
Prr14l A G 5: 32,828,984 C1056R probably damaging Het
Ptpn23 A G 9: 110,389,794 probably benign Het
Serpinb5 T A 1: 106,875,072 Y112* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdrd5 A G 1: 156,285,483 V409A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Trpm3 A T 19: 22,987,449 N1436I probably benign Het
Unc13c A T 9: 73,930,958 S870R probably benign Het
Vmn2r16 C T 5: 109,362,277 P509S probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfp729a A T 13: 67,621,319 C264S probably damaging Het
Zmynd8 T A 2: 165,815,461 K521* probably null Het
Other mutations in Tmem8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Tmem8b APN 4 43689434 missense probably benign 0.15
IGL02677:Tmem8b APN 4 43686092 missense probably damaging 1.00
IGL03090:Tmem8b APN 4 43689721 missense probably damaging 0.99
IGL03379:Tmem8b APN 4 43685561 missense probably benign 0.42
R0321:Tmem8b UTSW 4 43674444 missense probably damaging 1.00
R0377:Tmem8b UTSW 4 43674005 missense probably damaging 1.00
R0456:Tmem8b UTSW 4 43685618 missense probably benign 0.04
R0629:Tmem8b UTSW 4 43669896 utr 5 prime probably null
R0646:Tmem8b UTSW 4 43690123 missense probably benign 0.01
R0690:Tmem8b UTSW 4 43674562 missense possibly damaging 0.69
R1484:Tmem8b UTSW 4 43690234 missense probably benign 0.01
R1558:Tmem8b UTSW 4 43681134 missense possibly damaging 0.95
R1733:Tmem8b UTSW 4 43690228 unclassified probably null
R1999:Tmem8b UTSW 4 43681300 missense probably damaging 0.99
R2414:Tmem8b UTSW 4 43673892 splice site probably benign
R3799:Tmem8b UTSW 4 43673892 splice site probably benign
R3821:Tmem8b UTSW 4 43689745 missense probably damaging 0.99
R4581:Tmem8b UTSW 4 43685760 missense probably damaging 1.00
R4852:Tmem8b UTSW 4 43689713 missense probably damaging 0.99
R5214:Tmem8b UTSW 4 43673992 missense probably benign 0.09
R5311:Tmem8b UTSW 4 43673992 missense probably benign 0.09
R5448:Tmem8b UTSW 4 43673992 missense probably benign 0.09
R5449:Tmem8b UTSW 4 43673992 missense probably benign 0.09
R5450:Tmem8b UTSW 4 43673992 missense probably benign 0.09
R6245:Tmem8b UTSW 4 43690246 missense probably benign 0.14
R6615:Tmem8b UTSW 4 43682249 missense probably damaging 1.00
R6693:Tmem8b UTSW 4 43669837 missense probably benign 0.00
R6944:Tmem8b UTSW 4 43674465 missense probably damaging 1.00
R6994:Tmem8b UTSW 4 43690192 missense probably damaging 0.96
R7136:Tmem8b UTSW 4 43669845 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CAAGCAGGTTAGTCTAGGGTAC -3'
(R):5'- AAGCCAGAGCCAGTTCAGAC -3'

Sequencing Primer
(F):5'- TACGTCCTGGGAGACAAGC -3'
(R):5'- GGTGGCACCTGTCAAAAATTG -3'
Posted On2015-04-02