Incidental Mutation 'R3870:Togaram1'
ID276527
Institutional Source Beutler Lab
Gene Symbol Togaram1
Ensembl Gene ENSMUSG00000035614
Gene NameTOG array regulator of axonemal microtubules 1
SynonymsFam179b, A430041B07Rik
MMRRC Submission 040789-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.640) question?
Stock #R3870 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location64965804-65022573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 65002645 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1285 (E1285D)
Ref Sequence ENSEMBL: ENSMUSP00000152616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066296] [ENSMUST00000223166]
Predicted Effect probably benign
Transcript: ENSMUST00000066296
AA Change: E1235D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000070382
Gene: ENSMUSG00000035614
AA Change: E1235D

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
TOG 339 574 3.38e-23 SMART
low complexity region 804 815 N/A INTRINSIC
low complexity region 988 1001 N/A INTRINSIC
low complexity region 1011 1024 N/A INTRINSIC
low complexity region 1033 1041 N/A INTRINSIC
coiled coil region 1177 1206 N/A INTRINSIC
TOG 1251 1486 4.37e-8 SMART
TOG 1533 1776 1.53e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223166
AA Change: E1285D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 90% (61/68)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,231,404 probably null Het
2410089E03Rik A T 15: 8,218,464 K1499M probably damaging Het
Adam22 C A 5: 8,132,418 C514F probably damaging Het
Akap8 G A 17: 32,317,839 probably benign Het
Armcx2 A T X: 134,806,299 V195E probably benign Het
Atg7 T C 6: 114,697,047 S301P possibly damaging Het
Cc2d2a C A 5: 43,718,691 Y1003* probably null Het
Ccdc93 A G 1: 121,463,114 S272G probably benign Het
Ces1d C G 8: 93,175,086 L418F probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ehd4 T A 2: 120,136,953 D120V probably damaging Het
Eif4g3 T A 4: 138,096,900 V71E probably damaging Het
Exoc5 A G 14: 49,019,396 probably benign Het
Glud1 T A 14: 34,325,580 probably benign Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm11555 G T 11: 99,649,990 C64* probably null Het
Gm5468 A G 15: 25,414,475 probably benign Het
Gpatch2 T A 1: 187,322,294 L74Q probably damaging Het
Hnrnpa0 G A 13: 58,127,899 R139C probably damaging Het
Hrh1 A G 6: 114,480,919 Y387C probably damaging Het
Ldb3 A T 14: 34,567,483 D216E probably damaging Het
Lingo1 A T 9: 56,619,725 S533T probably benign Het
Lmtk2 T G 5: 144,166,427 probably benign Het
Map1s A G 8: 70,917,101 E939G possibly damaging Het
Mast1 G A 8: 84,918,731 T695I probably damaging Het
Mettl21e G A 1: 44,206,364 R241W probably benign Het
Mfsd4a G A 1: 132,046,353 T261I probably damaging Het
Mmel1 T C 4: 154,883,638 S144P probably benign Het
Myo16 A T 8: 10,442,239 H727L probably benign Het
Ncoa6 T C 2: 155,415,557 probably null Het
Nipa2 T C 7: 55,932,942 R352G probably damaging Het
Oaf C T 9: 43,222,758 R222Q probably benign Het
Olfr701 T A 7: 106,818,840 Y252* probably null Het
Pard3 T C 8: 127,409,686 S847P probably damaging Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Plcb1 A C 2: 135,325,671 I462L probably damaging Het
Prex2 T C 1: 11,160,192 V814A possibly damaging Het
Rasal3 G A 17: 32,393,548 R780W possibly damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Ryk A G 9: 102,891,228 E359G probably damaging Het
Sall2 C A 14: 52,313,994 L579F probably damaging Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Scg3 T C 9: 75,675,499 probably benign Het
Slc35f5 A G 1: 125,562,361 T65A probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Stat2 T A 10: 128,277,893 S180R probably benign Het
Stxbp2 A G 8: 3,634,079 T129A probably damaging Het
Tas1r3 A T 4: 155,861,353 C529S probably damaging Het
Tlr12 T A 4: 128,616,568 M630L probably benign Het
Tnfrsf10b T G 14: 69,773,456 D103E probably benign Het
Tppp A G 13: 74,030,772 T111A probably benign Het
Trim12c T C 7: 104,348,337 Q4R probably benign Het
Ttbk2 T G 2: 120,740,019 S1149R probably damaging Het
Uncx T C 5: 139,547,365 L395P probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 A T 11: 85,007,055 Y1153* probably null Het
Vmn2r6 T C 3: 64,556,621 E264G probably damaging Het
Vmn2r77 T C 7: 86,811,842 F792S probably damaging Het
Vps13c A G 9: 67,884,726 I425V probably benign Het
Vstm4 C T 14: 32,863,755 A93V probably benign Het
Xrcc6 T A 15: 82,025,684 S97T probably benign Het
Zscan20 A G 4: 128,586,425 C758R probably damaging Het
Other mutations in Togaram1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Togaram1 APN 12 65006399 missense probably damaging 1.00
IGL01128:Togaram1 APN 12 64980876 missense probably benign 0.01
IGL01406:Togaram1 APN 12 64995578 missense possibly damaging 0.81
IGL01534:Togaram1 APN 12 64966547 missense probably damaging 0.99
IGL01569:Togaram1 APN 12 64982662 missense possibly damaging 0.81
IGL01927:Togaram1 APN 12 64976702 missense probably benign 0.31
IGL02066:Togaram1 APN 12 64983421 missense probably damaging 1.00
IGL02746:Togaram1 APN 12 64966496 nonsense probably null
IGL02878:Togaram1 APN 12 64992626 missense possibly damaging 0.60
IGL02947:Togaram1 APN 12 65021500 missense probably damaging 1.00
IGL02961:Togaram1 APN 12 64966710 missense probably damaging 1.00
PIT4810001:Togaram1 UTSW 12 64983512 missense probably damaging 1.00
R0483:Togaram1 UTSW 12 65007031 missense probably damaging 1.00
R0519:Togaram1 UTSW 12 64966002 unclassified probably benign
R0584:Togaram1 UTSW 12 64967505 missense probably damaging 1.00
R0646:Togaram1 UTSW 12 65021466 missense probably damaging 1.00
R0749:Togaram1 UTSW 12 64982698 missense possibly damaging 0.87
R0891:Togaram1 UTSW 12 64982647 missense probably benign 0.01
R1111:Togaram1 UTSW 12 65006341 missense probably damaging 1.00
R1349:Togaram1 UTSW 12 65011145 missense probably damaging 0.99
R1531:Togaram1 UTSW 12 64966265 missense probably benign 0.01
R1618:Togaram1 UTSW 12 64967073 missense possibly damaging 0.47
R1672:Togaram1 UTSW 12 65021568 missense probably benign 0.00
R1789:Togaram1 UTSW 12 65002635 missense possibly damaging 0.47
R1822:Togaram1 UTSW 12 64995635 missense probably damaging 0.98
R1930:Togaram1 UTSW 12 64966935 missense probably damaging 1.00
R1931:Togaram1 UTSW 12 64966935 missense probably damaging 1.00
R2006:Togaram1 UTSW 12 65019140 missense probably damaging 1.00
R2018:Togaram1 UTSW 12 65002659 missense possibly damaging 0.76
R2304:Togaram1 UTSW 12 64976856 splice site probably null
R2345:Togaram1 UTSW 12 65008632 missense probably benign 0.05
R2407:Togaram1 UTSW 12 64967670 missense probably damaging 1.00
R2853:Togaram1 UTSW 12 65016612 missense probably benign 0.40
R3123:Togaram1 UTSW 12 64966344 missense probably damaging 1.00
R3124:Togaram1 UTSW 12 64966344 missense probably damaging 1.00
R3125:Togaram1 UTSW 12 64966344 missense probably damaging 1.00
R3693:Togaram1 UTSW 12 64983509 missense probably benign 0.34
R3857:Togaram1 UTSW 12 64980859 missense possibly damaging 0.64
R3871:Togaram1 UTSW 12 65002645 missense probably benign 0.00
R4398:Togaram1 UTSW 12 64980856 missense probably benign
R4578:Togaram1 UTSW 12 65020326 missense probably damaging 1.00
R4579:Togaram1 UTSW 12 64967907 missense probably damaging 1.00
R4621:Togaram1 UTSW 12 64982450 missense possibly damaging 0.87
R4623:Togaram1 UTSW 12 64982450 missense possibly damaging 0.87
R4655:Togaram1 UTSW 12 64967120 missense possibly damaging 0.91
R5080:Togaram1 UTSW 12 64983403 missense probably benign 0.02
R5459:Togaram1 UTSW 12 64967736 missense probably damaging 1.00
R5652:Togaram1 UTSW 12 65016650 missense probably benign 0.13
R5857:Togaram1 UTSW 12 64995557 missense possibly damaging 0.64
R5997:Togaram1 UTSW 12 64995538 missense probably benign 0.00
R6090:Togaram1 UTSW 12 64967801 missense probably benign 0.07
R6117:Togaram1 UTSW 12 64967487 missense probably damaging 1.00
R6221:Togaram1 UTSW 12 64966546 missense probably damaging 1.00
R6505:Togaram1 UTSW 12 64966590 missense possibly damaging 0.78
R6545:Togaram1 UTSW 12 64978207 missense possibly damaging 0.90
R6706:Togaram1 UTSW 12 65002609 missense probably benign 0.16
R7041:Togaram1 UTSW 12 65020386 missense possibly damaging 0.76
R7199:Togaram1 UTSW 12 64995518 missense probably benign
R7284:Togaram1 UTSW 12 65008680 missense probably benign 0.09
X0021:Togaram1 UTSW 12 64966184 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTCAGTGTCAAGTTTTAGTTCTTC -3'
(R):5'- AAAATGCCACCAGGTGCTCC -3'

Sequencing Primer
(F):5'- CTTCAAATAGTCAGTCTTGCATAGTC -3'
(R):5'- AGGTGCTCCAGCTGAAAC -3'
Posted On2015-04-06