Incidental Mutation 'R4377:C330007P06Rik'
ID325175
Institutional Source Beutler Lab
Gene Symbol C330007P06Rik
Ensembl Gene ENSMUSG00000006423
Gene NameRIKEN cDNA C330007P06 gene
Synonyms
MMRRC Submission 041676-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R4377 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location36823737-36874111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36824159 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 206 (C206F)
Ref Sequence ENSEMBL: ENSMUSP00000110904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115249]
Predicted Effect probably benign
Transcript: ENSMUST00000115249
AA Change: C206F

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000110904
Gene: ENSMUSG00000006423
AA Change: C206F

DomainStartEndE-ValueType
low complexity region 158 177 N/A INTRINSIC
Meta Mutation Damage Score 0.1232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] While this gene is well-supported by transcript data, no functional information on its protein products is currently available. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Male chimeras hemizygous for a gene trapped allele exhibit abnormal midbrain-hindbrain boundary morphology and decreased forebrain size. A subset of male chimeras hemizygous for a different gene trapped allele exhibit embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Arhgap22 A G 14: 33,369,510 M681V probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
BC034090 A G 1: 155,232,450 C384R probably benign Het
Ccdc180 T A 4: 45,941,877 L1380Q probably damaging Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cenpp A G 13: 49,494,431 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Csn1s2a T C 5: 87,775,821 V12A probably benign Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Frmd3 T A 4: 74,128,298 probably null Het
Gart G A 16: 91,634,094 A360V probably benign Het
Gm7251 T A 13: 49,805,200 noncoding transcript Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Itgal A G 7: 127,328,281 Y981C probably benign Het
Kcp C T 6: 29,493,203 C107Y probably damaging Het
Kdm2a C T 19: 4,329,054 V138M probably benign Het
Kit T C 5: 75,640,499 I515T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
Krt33a T C 11: 100,012,427 E263G possibly damaging Het
Mark2 T C 19: 7,290,689 I50V possibly damaging Het
Mug2 G T 6: 122,071,007 probably null Het
Mvk A G 5: 114,452,961 probably benign Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naa15 T C 3: 51,448,365 I229T possibly damaging Het
Napb A C 2: 148,732,264 probably null Het
Ncoa3 T G 2: 166,054,497 L440R possibly damaging Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr965 T A 9: 39,719,807 F193L probably benign Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plekha5 T C 6: 140,579,465 Y376H probably damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Ptprc A T 1: 138,067,925 M982K probably benign Het
Ptpro T A 6: 137,380,266 F252I probably benign Het
Pusl1 A G 4: 155,890,580 V188A probably benign Het
Rad54l2 A G 9: 106,693,222 S1300P probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Rtel1 T A 2: 181,355,796 H1104Q probably damaging Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Skint6 T C 4: 113,236,518 T143A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfp583 A G 7: 6,317,681 S111P possibly damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in C330007P06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4375:C330007P06Rik UTSW X 36824159 missense probably benign 0.03
R4376:C330007P06Rik UTSW X 36824159 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGCGAACGGTTTCTGATTTC -3'
(R):5'- ACTGCTAACACTTGGAGGAAG -3'

Sequencing Primer
(F):5'- CTATTGAGGTTTGAGCCTTTCC -3'
(R):5'- GGACCTTCCCACACACTCACTAG -3'
Posted On2015-07-06